EMAIL THIS PAGE TO A FRIEND

PMP2

peripheral myelin protein 2

74 Gene Product Result for
Synonyms: FABP8 M-FABP MP2 P2
UniProtKB ID: P02689, Q6FHL4
Gene ID:
Mouse(18857) peripheral myelin protein 2
Rat(688790) peripheral myelin protein 2
chicken(420198) peripheral myelin protein 2
dog(487015) peripheral myelin protein 2
domestic cat(101086947) peripheral myelin protein 2
cow(506062) peripheral myelin protein 2
sheep(101113077) peripheral myelin protein 2
domestic guinea pig(100732635) peripheral myelin protein 2
naked mole-rat(101707545) peripheral myelin protein 2
Domestic Rabbit(100009045) peripheral myelin protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301669 Anti-PMP2 affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB1100621 Anti-PMP2 (72-85) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001030305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001030305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001030305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU197071 MISSION® esiRNA esiRNA targeting mouse Pmp2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002677 Rosetta Predictions human pricing
NM_001109514 Rosetta Predictions rat pricing
NM_001030305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334244 predicted 212
2 SASI_Hs01_00206872 predicted 541
3 SASI_Hs01_00206873 predicted 250
4 SASI_Hs01_00206874 predicted 239
5 SASI_Hs01_00206875 predicted 227
6 SASI_Hs01_00206876 predicted 672
7 SASI_Hs02_00334245 predicted 395
8 SASI_Hs01_00206877 predicted 725
9 SASI_Hs01_00206880 predicted 733
10 SASI_Hs01_00206881 predicted 287
11 SASI_Hs01_00206878 predicted 321
12 SASI_Hs01_00206879 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249149 predicted 462
2 SASI_Rn02_00249150 predicted 337
3 SASI_Rn02_00249151 predicted 408
4 SASI_Rn02_00249152 predicted 405
5 SASI_Rn02_00249153 predicted 630
6 SASI_Rn02_00249154 predicted 379
7 SASI_Rn02_00249155 predicted 694
8 SASI_Rn02_00249156 predicted 468
9 SASI_Rn02_00249157 predicted 472
10 SASI_Rn02_00249158 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288131 predicted 950
2 SASI_Mm01_00075663 predicted 572
3 SASI_Mm01_00075664 predicted 896
4 SASI_Mm01_00075665 predicted 400
5 SASI_Mm01_00075667 predicted 655
6 SASI_Mm01_00075668 predicted 207
7 SASI_Mm01_00075669 predicted 742
8 SASI_Mm01_00075670 predicted 562
9 SASI_Mm01_00075671 predicted 257
10 SASI_Mm01_00075672 predicted 941
11 SASI_Mm01_00075666 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002677
PMP2 MISSION shRNA Bacterial Glycerol Stock
peripheral myelin protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-613s21c1
Sequence:CCGGCAGATATGCAAAGGCCTAAACCTCGAGGTTTAGGCCTTTGCATATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-675s21c1
Sequence:CCGGATGTGCATGCATGTCATTATTCTCGAGAATAATGACATGCATGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-370s1c1
Sequence:CCGGCACTGAATCAAGTGCAGAGATCTCGAGATCTCTGCACTTGATTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-254s1c1
Sequence:CCGGACGAACTGAAAGTACCTTTAACTCGAGTTAAAGGTACTTTCAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-226s1c1
Sequence:CCGGTCAGCAAGAAAGGAGATATTACTCGAGTAATATCTCCTTTCTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-136s1c1
Sequence:CCGGCTAGTGAGAACTTTGACGATTCTCGAGAATCGTCAAAGTTCTCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c1
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c2
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002677
PMP2 MISSION shRNA shRNA Plasmid DNA
peripheral myelin protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-613s21c1
Sequence:CCGGCAGATATGCAAAGGCCTAAACCTCGAGGTTTAGGCCTTTGCATATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-675s21c1
Sequence:CCGGATGTGCATGCATGTCATTATTCTCGAGAATAATGACATGCATGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-370s1c1
Sequence:CCGGCACTGAATCAAGTGCAGAGATCTCGAGATCTCTGCACTTGATTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-254s1c1
Sequence:CCGGACGAACTGAAAGTACCTTTAACTCGAGTTAAAGGTACTTTCAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-226s1c1
Sequence:CCGGTCAGCAAGAAAGGAGATATTACTCGAGTAATATCTCCTTTCTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-136s1c1
Sequence:CCGGCTAGTGAGAACTTTGACGATTCTCGAGAATCGTCAAAGTTCTCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c1
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c2
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002677
PMP2 MISSION shRNA Lentiviral Transduction Particles
peripheral myelin protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-613s21c1
Sequence:CCGGCAGATATGCAAAGGCCTAAACCTCGAGGTTTAGGCCTTTGCATATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002677.3-675s21c1
Sequence:CCGGATGTGCATGCATGTCATTATTCTCGAGAATAATGACATGCATGCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-370s1c1
Sequence:CCGGCACTGAATCAAGTGCAGAGATCTCGAGATCTCTGCACTTGATTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-254s1c1
Sequence:CCGGACGAACTGAAAGTACCTTTAACTCGAGTTAAAGGTACTTTCAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-226s1c1
Sequence:CCGGTCAGCAAGAAAGGAGATATTACTCGAGTAATATCTCCTTTCTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-136s1c1
Sequence:CCGGCTAGTGAGAACTTTGACGATTCTCGAGAATCGTCAAAGTTCTCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c1
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002677.3-475s1c2
Sequence:CCGGCCAGAATCTATGAGAAGGTCTCTCGAGAGACCTTCTCATAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030305
PMP2 MISSION shRNA Bacterial Glycerol Stock
peripheral myelin protein 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030305.2-731s1c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-213s21c1
Sequence:CCGGTATCACCATTAGAACGGAAAGCTCGAGCTTTCCGTTCTAATGGTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-404s21c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-431s21c1
Sequence:CCGGGTGTGGTCTGCACCAGAATTTCTCGAGAAATTCTGGTGCAGACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030305.2-731s21c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-267s21c1
Sequence:CCGGGGGCCAGGAGTTTGATGAAACCTCGAGGTTTCATCAAACTCCTGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030305.1-404s1c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030305
PMP2 MISSION shRNA shRNA Plasmid DNA
peripheral myelin protein 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030305.2-731s1c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-213s21c1
Sequence:CCGGTATCACCATTAGAACGGAAAGCTCGAGCTTTCCGTTCTAATGGTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-404s21c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-431s21c1
Sequence:CCGGGTGTGGTCTGCACCAGAATTTCTCGAGAAATTCTGGTGCAGACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030305.2-731s21c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-267s21c1
Sequence:CCGGGGGCCAGGAGTTTGATGAAACCTCGAGGTTTCATCAAACTCCTGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030305.1-404s1c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030305
PMP2 MISSION shRNA Lentiviral Transduction Particles
peripheral myelin protein 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215534    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030305.2-731s1c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-213s21c1
Sequence:CCGGTATCACCATTAGAACGGAAAGCTCGAGCTTTCCGTTCTAATGGTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-404s21c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-431s21c1
Sequence:CCGGGTGTGGTCTGCACCAGAATTTCTCGAGAAATTCTGGTGCAGACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001030305.2-731s21c1
Sequence:CCGGGCTGTGCTCATTCTGATTTAACTCGAGTTAAATCAGAATGAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001030305.2-267s21c1
Sequence:CCGGGGGCCAGGAGTTTGATGAAACCTCGAGGTTTCATCAAACTCCTGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030305.1-404s1c1
Sequence:CCGGGAATGGTAGTGGAGTGTATAACTCGAGTTATACACTCCACTACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)