EMAIL THIS PAGE TO A FRIEND

PMS1

PMS1 postmeiotic segregation increased 1 (S. cerevisiae)

93 Gene Product Result for
Synonyms: HNPCC3 PMSL1 hPMS1
UniProtKB ID: P54277, D3DPI1, Q4VAL4, Q5FBZ3, Q5FBZ8
Gene ID:
Human(5378) Summary: This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
Mouse(227099) postmeiotic segregation increased 1 (S. cerevisiae)
Rat(494322) postmeiotic segregation increased 1 (S. cerevisiae)
Thale Cress(827997) DNA mismatch repair protein PMS1
domestic cat(101081070) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Horse(100054470) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
dog(478840) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Zebrafish(368631) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
chicken(423980) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
cow(529491) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
sheep(101111691) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Domestic Rabbit(100342037) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
domestic guinea pig(100713513) PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005341 MISSION® esiRNA esiRNA targeting human PMS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000534 Rosetta Predictions human pricing
NM_001128143 Rosetta Predictions human pricing
NM_001128144 Rosetta Predictions human pricing
NM_001009535 Rosetta Predictions rat pricing
NM_153556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036756 predicted 2692
2 SASI_Hs01_00036757 predicted 1456
3 SASI_Hs01_00036759 predicted 1406
4 SASI_Hs01_00036761 predicted 2651
5 SASI_Hs01_00036762 predicted 2883
6 SASI_Hs01_00036764 predicted 2392
7 SASI_Hs01_00036765 predicted 1638
8 SASI_Hs02_00302747 predicted 2107
9 SASI_Hs02_00302748 predicted 2133
10 SASI_Hs02_00302749 predicted 2481
11 SASI_Hs01_00036758 predicted 1241
12 SASI_Hs01_00036760 predicted 2485
13 SASI_Hs01_00036763 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330556 predicted 2876
2 SASI_Hs02_00330557 predicted 1646
3 SASI_Hs02_00330558 predicted 1588
4 SASI_Hs02_00330559 predicted 2833
5 SASI_Hs02_00330560 predicted 3066
6 SASI_Hs02_00330561 predicted 2574
7 SASI_Hs02_00330562 predicted 1820
8 SASI_Hs02_00330563 predicted 2291
9 SASI_Hs02_00330564 predicted 2321
10 SASI_Hs02_00330565 predicted 2662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330566 predicted 2476
2 SASI_Hs02_00330567 predicted 1821
3 SASI_Hs02_00330568 predicted 2502
4 SASI_Hs02_00330569 predicted 1759
5 SASI_Hs02_00330570 predicted 1538
6 SASI_Hs02_00330571 predicted 1702
7 SASI_Hs02_00330572 predicted 2463
8 SASI_Hs02_00330573 predicted 2700
9 SASI_Hs02_00330574 predicted 2241
10 SASI_Hs02_00330575 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080489 predicted 2632
2 SASI_Rn01_00080490 predicted 529
3 SASI_Rn01_00080491 predicted 2358
4 SASI_Rn02_00199591 predicted 2592
5 SASI_Rn02_00199592 predicted 2540
6 SASI_Rn02_00199593 predicted 2552
7 SASI_Rn01_00080492 predicted 896
8 SASI_Rn01_00080495 predicted 2372
9 SASI_Rn01_00080496 predicted 851
10 SASI_Rn01_00080497 predicted 817
11 SASI_Rn01_00080493 predicted 755
12 SASI_Rn01_00080494 predicted 503
13 SASI_Rn01_00080498 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343337 predicted 2667
2 SASI_Mm02_00343338 predicted 2408
3 SASI_Mm01_00039458 predicted 1594
4 SASI_Mm01_00039459 predicted 1188
5 SASI_Mm01_00039460 predicted 805
6 SASI_Mm01_00039461 predicted 1569
7 SASI_Mm02_00343339 predicted 1742
8 SASI_Mm01_00039463 predicted 867
9 SASI_Mm01_00039464 predicted 2608
10 SASI_Mm02_00343340 predicted 1200
11 SASI_Mm01_00039455 predicted 1457
12 SASI_Mm01_00039456 predicted 1766
13 SASI_Mm01_00039457 predicted 2577
14 SASI_Mm01_00039462 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000534
VALIDATED
PMS1 MISSION shRNA Bacterial Glycerol Stock
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000534.4-3359s21c1
Sequence:CCGGTGAAATTGGTTCTGTCATAAACTCGAGTTTATGACAGAACCAATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-3137s21c1
Sequence:CCGGCCTCGCAAAGTGATAAGTTATCTCGAGATAACTTATCACTTTGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-1935s21c1
Sequence:CCGGATGGCAATAAAGACCATATAGCTCGAGCTATATGGTCTTTATTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-2413s21c1
Sequence:CCGGGGAACGATACAATAGTCAAATCTCGAGATTTGACTATTGTATCGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-1541s21c1
Sequence:CCGGGGACCATTACCTAGTACAAATCTCGAGATTTGTACTAGGTAATGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-193s1c1
Sequence:CCGGCAAGCGTAGATGTTAAACTGGCTCGAGCCAGTTTAACATCTACGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-402s1c1
Sequence:CCGGATTACAACAAGAACGGCTGCTCTCGAGAGCAGCCGTTCTTGTTGTAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-136s1c1
Sequence:CCGGCTTCGGTGGTCAGTGTTGTAACTCGAGTTACAACACTGACCACCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-276s1c1
Sequence:CCGGGCACCTGTAATGGCAATGAAGCTCGAGCTTCATTGCCATTACAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000534
VALIDATED
PMS1 MISSION shRNA shRNA Plasmid DNA
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000534.4-3359s21c1
Sequence:CCGGTGAAATTGGTTCTGTCATAAACTCGAGTTTATGACAGAACCAATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-3137s21c1
Sequence:CCGGCCTCGCAAAGTGATAAGTTATCTCGAGATAACTTATCACTTTGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-1935s21c1
Sequence:CCGGATGGCAATAAAGACCATATAGCTCGAGCTATATGGTCTTTATTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-2413s21c1
Sequence:CCGGGGAACGATACAATAGTCAAATCTCGAGATTTGACTATTGTATCGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-1541s21c1
Sequence:CCGGGGACCATTACCTAGTACAAATCTCGAGATTTGTACTAGGTAATGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-193s1c1
Sequence:CCGGCAAGCGTAGATGTTAAACTGGCTCGAGCCAGTTTAACATCTACGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-402s1c1
Sequence:CCGGATTACAACAAGAACGGCTGCTCTCGAGAGCAGCCGTTCTTGTTGTAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-136s1c1
Sequence:CCGGCTTCGGTGGTCAGTGTTGTAACTCGAGTTACAACACTGACCACCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-276s1c1
Sequence:CCGGGCACCTGTAATGGCAATGAAGCTCGAGCTTCATTGCCATTACAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000534
VALIDATED
PMS1 MISSION shRNA Lentiviral Transduction Particles
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000534.4-3359s21c1
Sequence:CCGGTGAAATTGGTTCTGTCATAAACTCGAGTTTATGACAGAACCAATTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-3137s21c1
Sequence:CCGGCCTCGCAAAGTGATAAGTTATCTCGAGATAACTTATCACTTTGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000534.4-1935s21c1
Sequence:CCGGATGGCAATAAAGACCATATAGCTCGAGCTATATGGTCTTTATTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-2413s21c1
Sequence:CCGGGGAACGATACAATAGTCAAATCTCGAGATTTGACTATTGTATCGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000534.4-1541s21c1
Sequence:CCGGGGACCATTACCTAGTACAAATCTCGAGATTTGTACTAGGTAATGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-193s1c1
Sequence:CCGGCAAGCGTAGATGTTAAACTGGCTCGAGCCAGTTTAACATCTACGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-402s1c1
Sequence:CCGGATTACAACAAGAACGGCTGCTCTCGAGAGCAGCCGTTCTTGTTGTAATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-136s1c1
Sequence:CCGGCTTCGGTGGTCAGTGTTGTAACTCGAGTTACAACACTGACCACCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000534.x-276s1c1
Sequence:CCGGGCACCTGTAATGGCAATGAAGCTCGAGCTTCATTGCCATTACAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153556
VALIDATED
PMS1 MISSION shRNA Bacterial Glycerol Stock
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153556.1-2890s1c1
Sequence:CCGGGCTTATGACCATTAGTTACTACTCGAGTAGTAACTAATGGTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-1197s1c1
Sequence:CCGGGCCAACATGGTTGTTAGTCAACTCGAGTTGACTAACAACCATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-442s1c1
Sequence:CCGGCGGAGGTGGTAGTTACAACAACTCGAGTTGTTGTAACTACCACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-893s1c1
Sequence:CCGGCCCAGAGAGAAGTTTCATCTTCTCGAGAAGATGAAACTTCTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-380s1c1
Sequence:CCGGCCTTGGAAATCTGACAACTTACTCGAGTAAGTTGTCAGATTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153556
VALIDATED
PMS1 MISSION shRNA shRNA Plasmid DNA
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153556.1-2890s1c1
Sequence:CCGGGCTTATGACCATTAGTTACTACTCGAGTAGTAACTAATGGTCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-1197s1c1
Sequence:CCGGGCCAACATGGTTGTTAGTCAACTCGAGTTGACTAACAACCATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-442s1c1
Sequence:CCGGCGGAGGTGGTAGTTACAACAACTCGAGTTGTTGTAACTACCACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-893s1c1
Sequence:CCGGCCCAGAGAGAAGTTTCATCTTCTCGAGAAGATGAAACTTCTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-380s1c1
Sequence:CCGGCCTTGGAAATCTGACAACTTACTCGAGTAAGTTGTCAGATTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153556
VALIDATED
PMS1 MISSION shRNA Lentiviral Transduction Particles
PMS1 postmeiotic segregation increased 1 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153556.1-2890s1c1
Sequence:CCGGGCTTATGACCATTAGTTACTACTCGAGTAGTAACTAATGGTCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-1197s1c1
Sequence:CCGGGCCAACATGGTTGTTAGTCAACTCGAGTTGACTAACAACCATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-442s1c1
Sequence:CCGGCGGAGGTGGTAGTTACAACAACTCGAGTTGTTGTAACTACCACCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-893s1c1
Sequence:CCGGCCCAGAGAGAAGTTTCATCTTCTCGAGAAGATGAAACTTCTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153556.1-380s1c1
Sequence:CCGGCCTTGGAAATCTGACAACTTACTCGAGTAAGTTGTCAGATTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)