EMAIL THIS PAGE TO A FRIEND

PMS2

PMS2 postmeiotic segregation increased 2 (S. cerevisiae)

68 Gene Product Result for
Synonyms: HNPCC4 PMS2CL PMSL2
Gene ID:
Human(5395) Summary: This gene is one of the PMS2 gene family members found in clusters on chromosome 7. The product of this gene is involved in DNA mismatch repair. It forms a heterodimer with MLH1 and this complex interacts with other complexes bound to mismatched bases. Mutations in this gene are associated with hereditary nonpolyposis colorectal cancer, Turcot syndrome, and are a cause of supratentorial primitive neuroectodermal tumors. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(18861) postmeiotic segregation increased 2 (S. cerevisiae)
Rat(288479) postmeiotic segregation increased 2 (S. cerevisiae)
domestic guinea pig(100726203) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Domestic Rabbit(100355997) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
naked mole-rat(101712682) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
cow(527039) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Goat(100861267) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
sheep(101115595) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
fruit fly(36705) CG8169 gene product from transcript CG8169-RA
Horse(100062380) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
domestic cat(101081349) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
dog(479751) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
chicken(101752182) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
chicken(101666852) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Zebrafish(565276) PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000535 Rosetta Predictions human pricing
NR_003085 Rosetta Predictions human pricing
NM_001105908 Rosetta Predictions rat pricing
NM_008886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175396 predicted 644
2 SASI_Hs02_00302750 predicted 1750
3 SASI_Hs01_00175397 predicted 2156
4 SASI_Hs01_00175398 predicted 2120
5 SASI_Hs01_00175399 predicted 2113
6 SASI_Hs02_00302751 predicted 1951
7 SASI_Hs01_00175400 predicted 1701
8 SASI_Hs01_00175401 predicted 2023
9 SASI_Hs01_00175403 predicted 818
10 SASI_Hs02_00302752 predicted 1084
11 SASI_Hs01_00175402 predicted 1043
12 SASI_Hs01_00175404 predicted 2274
13 SASI_Hs01_00175405 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378106 predicted 642
2 SASI_Hs02_00378107 predicted 1746
3 SASI_Hs02_00378108 predicted 2154
4 SASI_Hs02_00378109 predicted 2121
5 SASI_Hs02_00378110 predicted 2109
6 SASI_Hs02_00378111 predicted 1946
7 SASI_Hs02_00378112 predicted 1695
8 SASI_Hs02_00378113 predicted 2010
9 SASI_Hs02_00378114 predicted 821
10 SASI_Hs02_00378115 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213722 predicted 935
2 SASI_Rn02_00213723 predicted 1650
3 SASI_Rn02_00213724 predicted 2309
4 SASI_Rn02_00213725 predicted 2243
5 SASI_Rn02_00213726 predicted 2582
6 SASI_Rn02_00213727 predicted 2212
7 SASI_Rn02_00213728 predicted 2140
8 SASI_Rn02_00213729 predicted 1124
9 SASI_Rn02_00213730 predicted 1642
10 SASI_Rn02_00213731 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177448 predicted 1878
2 SASI_Mm01_00177449 predicted 1093
3 SASI_Mm01_00177450 predicted 613
4 SASI_Mm02_00314890 predicted 956
5 SASI_Mm01_00177452 predicted 1410
6 SASI_Mm01_00177453 predicted 1758
7 SASI_Mm01_00177454 predicted 2080
8 SASI_Mm01_00177455 predicted 209
9 SASI_Mm01_00177456 predicted 396
10 SASI_Mm02_00314891 predicted 1051
11 SASI_Mm01_00177451 predicted 1140
12 SASI_Mm01_00177457 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000535
PMS2 MISSION shRNA Bacterial Glycerol Stock
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-774s1c1
Sequence:CCGGCGTGTGTGAAGAGTACGGTTTCTCGAGAAACCGTACTCTTCACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1092s1c1
Sequence:CCGGGACCTCTTTGATAGGAATGTTCTCGAGAACATTCCTATCAAAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2302s1c1
Sequence:CCGGCCAGTCACTGAAAGGGCTAAACTCGAGTTTAGCCCTTTCAGTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1686s1c1
Sequence:CCGGCCAGGAAGATACCGGATGTAACTCGAGTTACATCCGGTATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2136s1c1
Sequence:CCGGCGAGAAGTATAACTTCGAGATCTCGAGATCTCGAAGTTATACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-264s21c1
Sequence:CCGGGGACTATGGAGTGGATCTTATCTCGAGATAAGATCCACTCCATAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-1068s21c1
Sequence:CCGGTGATTCAGAATGCGTTGATATCTCGAGATATCAACGCATTCTGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-2261s21c1
Sequence:CCGGCACCTCAGACTCTCAACTTAACTCGAGTTAAGTTGAGAGTCTGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000535
PMS2 MISSION shRNA shRNA Plasmid DNA
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-774s1c1
Sequence:CCGGCGTGTGTGAAGAGTACGGTTTCTCGAGAAACCGTACTCTTCACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1092s1c1
Sequence:CCGGGACCTCTTTGATAGGAATGTTCTCGAGAACATTCCTATCAAAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2302s1c1
Sequence:CCGGCCAGTCACTGAAAGGGCTAAACTCGAGTTTAGCCCTTTCAGTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1686s1c1
Sequence:CCGGCCAGGAAGATACCGGATGTAACTCGAGTTACATCCGGTATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2136s1c1
Sequence:CCGGCGAGAAGTATAACTTCGAGATCTCGAGATCTCGAAGTTATACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-264s21c1
Sequence:CCGGGGACTATGGAGTGGATCTTATCTCGAGATAAGATCCACTCCATAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-1068s21c1
Sequence:CCGGTGATTCAGAATGCGTTGATATCTCGAGATATCAACGCATTCTGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-2261s21c1
Sequence:CCGGCACCTCAGACTCTCAACTTAACTCGAGTTAAGTTGAGAGTCTGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000535
PMS2 MISSION shRNA Lentiviral Transduction Particles
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-774s1c1
Sequence:CCGGCGTGTGTGAAGAGTACGGTTTCTCGAGAAACCGTACTCTTCACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1092s1c1
Sequence:CCGGGACCTCTTTGATAGGAATGTTCTCGAGAACATTCCTATCAAAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2302s1c1
Sequence:CCGGCCAGTCACTGAAAGGGCTAAACTCGAGTTTAGCCCTTTCAGTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-1686s1c1
Sequence:CCGGCCAGGAAGATACCGGATGTAACTCGAGTTACATCCGGTATCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000535.2-2136s1c1
Sequence:CCGGCGAGAAGTATAACTTCGAGATCTCGAGATCTCGAAGTTATACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-264s21c1
Sequence:CCGGGGACTATGGAGTGGATCTTATCTCGAGATAAGATCCACTCCATAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-1068s21c1
Sequence:CCGGTGATTCAGAATGCGTTGATATCTCGAGATATCAACGCATTCTGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000535.5-2261s21c1
Sequence:CCGGCACCTCAGACTCTCAACTTAACTCGAGTTAAGTTGAGAGTCTGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008886
VALIDATED
PMS2 MISSION shRNA Bacterial Glycerol Stock
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2732s1c1
Sequence:CCGGCGTTGCCAATCTGGATGTCATCTCGAGATGACATCCAGATTGGCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008886.1-2803s1c1
Sequence:CCGGCGGTTTGCAAAGAGAAGGTTTCTCGAGAAACCTTCTCTTTGCAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2283s1c1
Sequence:CCGGGCGGATGAGAAGTACAACTTTCTCGAGAAAGTTGTACTTCTCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-2644s21c1
Sequence:CCGGCTTGTAGCATAGAGTTTATTACTCGAGTAATAAACTCTATGCTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-404s21c1
Sequence:CCGGACTAAGTGATGTCACTATATCCTCGAGGATATAGTGACATCACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.2-1798s1c1
Sequence:CCGGGACCCTCAAATGTCAACATTTCTCGAGAAATGTTGACATTTGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-455s21c1
Sequence:CCGGTCGACTGGTGTTTGACCATAACTCGAGTTATGGTCAAACACCAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-997s21c1
Sequence:CCGGACCGGCATCAGTACCCATTTGCTCGAGCAAATGGGTACTGATGCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-2327s21c1
Sequence:CCGGAGTCACTGAAAGGGCTAAATTCTCGAGAATTTAGCCCTTTCAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008886
VALIDATED
PMS2 MISSION shRNA shRNA Plasmid DNA
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2732s1c1
Sequence:CCGGCGTTGCCAATCTGGATGTCATCTCGAGATGACATCCAGATTGGCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008886.1-2803s1c1
Sequence:CCGGCGGTTTGCAAAGAGAAGGTTTCTCGAGAAACCTTCTCTTTGCAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2283s1c1
Sequence:CCGGGCGGATGAGAAGTACAACTTTCTCGAGAAAGTTGTACTTCTCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-2644s21c1
Sequence:CCGGCTTGTAGCATAGAGTTTATTACTCGAGTAATAAACTCTATGCTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-404s21c1
Sequence:CCGGACTAAGTGATGTCACTATATCCTCGAGGATATAGTGACATCACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.2-1798s1c1
Sequence:CCGGGACCCTCAAATGTCAACATTTCTCGAGAAATGTTGACATTTGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-455s21c1
Sequence:CCGGTCGACTGGTGTTTGACCATAACTCGAGTTATGGTCAAACACCAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-997s21c1
Sequence:CCGGACCGGCATCAGTACCCATTTGCTCGAGCAAATGGGTACTGATGCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-2327s21c1
Sequence:CCGGAGTCACTGAAAGGGCTAAATTCTCGAGAATTTAGCCCTTTCAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008886
VALIDATED
PMS2 MISSION shRNA Lentiviral Transduction Particles
PMS2 postmeiotic segregation increased 2 (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2732s1c1
Sequence:CCGGCGTTGCCAATCTGGATGTCATCTCGAGATGACATCCAGATTGGCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008886.1-2803s1c1
Sequence:CCGGCGGTTTGCAAAGAGAAGGTTTCTCGAGAAACCTTCTCTTTGCAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.1-2283s1c1
Sequence:CCGGGCGGATGAGAAGTACAACTTTCTCGAGAAAGTTGTACTTCTCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-2644s21c1
Sequence:CCGGCTTGTAGCATAGAGTTTATTACTCGAGTAATAAACTCTATGCTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-404s21c1
Sequence:CCGGACTAAGTGATGTCACTATATCCTCGAGGATATAGTGACATCACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008886.2-1798s1c1
Sequence:CCGGGACCCTCAAATGTCAACATTTCTCGAGAAATGTTGACATTTGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008886.2-455s21c1
Sequence:CCGGTCGACTGGTGTTTGACCATAACTCGAGTTATGGTCAAACACCAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-997s21c1
Sequence:CCGGACCGGCATCAGTACCCATTTGCTCGAGCAAATGGGTACTGATGCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008886.2-2327s21c1
Sequence:CCGGAGTCACTGAAAGGGCTAAATTCTCGAGAATTTAGCCCTTTCAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)