EMAIL THIS PAGE TO A FRIEND

PMS2L2

postmeiotic segregation increased 2-like 2 pseudogene

42 Gene Product Result for
Synonyms: PMS4
Species: Human PMS2L2(5380)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002679 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148741 MISSION® esiRNA esiRNA human PMS2L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002679 Rosetta Predictions human pricing
NR_003614 Rosetta Predictions human pricing
XR_042144 Rosetta Predictions human pricing
XR_042161 Rosetta Predictions human pricing
XR_042167 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069122 predicted 461
2 SASI_Hs01_00069123 predicted 453
3 SASI_Hs01_00069124 predicted 449
4 SASI_Hs01_00069125 predicted 458
5 SASI_Hs01_00069126 predicted 448
6 SASI_Hs01_00069127 predicted 449
7 SASI_Hs01_00069128 predicted 453
8 SASI_Hs01_00069129 predicted 461
9 SASI_Hs01_00069130 predicted 1009
10 SASI_Hs01_00069131 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379913 predicted 417
2 SASI_Hs02_00379914 predicted 400
3 SASI_Hs02_00379915 predicted 274
4 SASI_Hs02_00379916 predicted 65
5 SASI_Hs02_00379917 predicted 150
6 SASI_Hs02_00379918 predicted 172
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533415 predicted 2218
2 SASI_Hs02_00533416 predicted 2224
3 SASI_Hs02_00533417 predicted 2222
4 SASI_Hs02_00533418 predicted 967
5 SASI_Hs02_00533419 predicted 1076
6 SASI_Hs02_00533420 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533493 predicted 384
2 SASI_Hs02_00533494 predicted 552
3 SASI_Hs02_00533495 predicted 445
4 SASI_Hs02_00533496 predicted 388
5 SASI_Hs02_00533497 predicted 229
6 SASI_Hs02_00533498 predicted 377
7 SASI_Hs02_00533499 predicted 227
8 SASI_Hs02_00533500 predicted 388
9 SASI_Hs02_00533501 predicted 65
10 SASI_Hs02_00533502 predicted 39
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533524 predicted 2223
2 SASI_Hs02_00533525 predicted 2218
3 SASI_Hs02_00533526 predicted 2221
4 SASI_Hs02_00533527 predicted 967
5 SASI_Hs02_00533528 predicted 1081
6 SASI_Hs02_00533529 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002679
PMS2L2 MISSION shRNA Bacterial Glycerol Stock
postmeiotic segregation increased 2-like 2 pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002679.1-921s1c1
Sequence:CCGGGACTTCAAGGAATGGGTCCTTCTCGAGAAGGACCCATTCCTTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-564s1c1
Sequence:CCGGGCACTGAGTGATGTCACCATTCTCGAGAATGGTGACATCACTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-455s1c1
Sequence:CCGGCTTATCTCTTTCAGCTCTGAACTCGAGTTCAGAGCTGAAAGAGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-454s1c1
Sequence:CCGGGCTTATCTCTTTCAGCTCTGACTCGAGTCAGAGCTGAAAGAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-843s1c1
Sequence:CCGGCTGACTGTAACTGGAGAGCTACTCGAGTAGCTCTCCAGTTACAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002679
PMS2L2 MISSION shRNA shRNA Plasmid DNA
postmeiotic segregation increased 2-like 2 pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002679.1-921s1c1
Sequence:CCGGGACTTCAAGGAATGGGTCCTTCTCGAGAAGGACCCATTCCTTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-564s1c1
Sequence:CCGGGCACTGAGTGATGTCACCATTCTCGAGAATGGTGACATCACTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-455s1c1
Sequence:CCGGCTTATCTCTTTCAGCTCTGAACTCGAGTTCAGAGCTGAAAGAGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-454s1c1
Sequence:CCGGGCTTATCTCTTTCAGCTCTGACTCGAGTCAGAGCTGAAAGAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-843s1c1
Sequence:CCGGCTGACTGTAACTGGAGAGCTACTCGAGTAGCTCTCCAGTTACAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002679
PMS2L2 MISSION shRNA Lentiviral Transduction Particles
postmeiotic segregation increased 2-like 2 pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002679.1-921s1c1
Sequence:CCGGGACTTCAAGGAATGGGTCCTTCTCGAGAAGGACCCATTCCTTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-564s1c1
Sequence:CCGGGCACTGAGTGATGTCACCATTCTCGAGAATGGTGACATCACTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-455s1c1
Sequence:CCGGCTTATCTCTTTCAGCTCTGAACTCGAGTTCAGAGCTGAAAGAGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-454s1c1
Sequence:CCGGGCTTATCTCTTTCAGCTCTGACTCGAGTCAGAGCTGAAAGAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002679.1-843s1c1
Sequence:CCGGCTGACTGTAACTGGAGAGCTACTCGAGTAGCTCTCCAGTTACAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)