EMAIL THIS PAGE TO A FRIEND

PMVK

phosphomevalonate kinase

61 Gene Product Result for
Synonyms: HUMPMKI PMK PMKA PMKASE
UniProtKB ID: Q15126, Q5TZW9
Gene ID:
Human(10654) Summary: This gene encodes a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of this protein is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis. [provided by RefSeq, Sep 2011]
Mouse(68603) phosphomevalonate kinase
Rat(310645) phosphomevalonate kinase
cow(513533) phosphomevalonate kinase
sheep(101113026) phosphomevalonate kinase
naked mole-rat(101720089) phosphomevalonate kinase
domestic guinea pig(100733721) phosphomevalonate kinase
Zebrafish(100003383) phosphomevalonate kinase
domestic cat(101096787) phosphomevalonate kinase
chicken(101747962) phosphomevalonate kinase
chicken(101666934) phosphomevalonate kinase
dog(612251) phosphomevalonate kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006556 Rosetta Predictions human pricing
NM_001008352 Rosetta Predictions rat pricing
NM_026784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097458 predicted 597
2 SASI_Hs01_00097459 predicted 621
3 SASI_Hs01_00097461 predicted 781
4 SASI_Hs01_00097462 predicted 900
5 SASI_Hs02_00341823 predicted 481
6 SASI_Hs01_00097463 predicted 764
7 SASI_Hs01_00097464 predicted 1048
8 SASI_Hs01_00097466 predicted 383
9 SASI_Hs02_00341824 predicted 662
10 SASI_Hs02_00341825 predicted 656
11 SASI_Hs01_00097460 predicted 847
12 SASI_Hs01_00097465 predicted 645
13 SASI_Hs01_00097467 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035541 predicted 319
2 SASI_Rn01_00035542 predicted 588
3 SASI_Rn01_00035543 predicted 345
4 SASI_Rn01_00035544 predicted 378
5 SASI_Rn01_00035546 predicted 732
6 SASI_Rn02_00199105 predicted 712
7 SASI_Rn02_00199106 predicted 587
8 SASI_Rn01_00035547 predicted 420
9 SASI_Rn01_00035548 predicted 662
10 SASI_Rn01_00035549 predicted 487
11 SASI_Rn01_00035545 predicted 351
12 SASI_Rn01_00035550 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152810 predicted 328
2 SASI_Mm01_00152811 predicted 654
3 SASI_Mm01_00152812 predicted 730
4 SASI_Mm02_00330874 predicted 767
5 SASI_Mm02_00330875 predicted 760
6 SASI_Mm01_00152813 predicted 725
7 SASI_Mm01_00152814 predicted 383
8 SASI_Mm01_00152815 predicted 264
9 SASI_Mm01_00152816 predicted 309
10 SASI_Mm01_00152817 predicted 193
11 SASI_Mm01_00152818 predicted 257
12 SASI_Mm01_00152819 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026784
VALIDATED
PMVK MISSION shRNA Bacterial Glycerol Stock
phosphomevalonate kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-429s21c1
Sequence:CCGGGATACAGACAGTCCGAGTAGTCTCGAGACTACTCGGACTGTCTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-608s1c1
Sequence:CCGGCTGGGATTTATTCAAGCCAAACTCGAGTTTGGCTTGAATAAATCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-389s1c1
Sequence:CCGGACATCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-554s1c1
Sequence:CCGGGTCATTGAGAACCACGGAGATCTCGAGATCTCCGTGGTTCTCAATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-90s1c1
Sequence:CCGGTGCTGTTTAGCGGGAAGAGAACTCGAGTTCTCTTCCCGCTAAACAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-527s1c1
Sequence:CCGGCTGGACAACTTTGGGAACTTTCTCGAGAAAGTTCCCAAAGTTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026784.2-769s21c1
Sequence:CCGGTCGTGAGTAGTGGGCAAATAACTCGAGTTATTTGCCCACTACTCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-144s21c1
Sequence:CCGGGAGCAGACTTGGAGGTAACATCTCGAGATGTTACCTCCAAGTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-240s21c1
Sequence:CCGGTCTGGATGCGAGCACCTACAACTCGAGTTGTAGGTGCTCGCATCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-188s21c1
Sequence:CCGGGTCCACTCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGAGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026784
VALIDATED
PMVK MISSION shRNA shRNA Plasmid DNA
phosphomevalonate kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-429s21c1
Sequence:CCGGGATACAGACAGTCCGAGTAGTCTCGAGACTACTCGGACTGTCTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-608s1c1
Sequence:CCGGCTGGGATTTATTCAAGCCAAACTCGAGTTTGGCTTGAATAAATCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-389s1c1
Sequence:CCGGACATCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-554s1c1
Sequence:CCGGGTCATTGAGAACCACGGAGATCTCGAGATCTCCGTGGTTCTCAATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-90s1c1
Sequence:CCGGTGCTGTTTAGCGGGAAGAGAACTCGAGTTCTCTTCCCGCTAAACAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-527s1c1
Sequence:CCGGCTGGACAACTTTGGGAACTTTCTCGAGAAAGTTCCCAAAGTTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026784.2-769s21c1
Sequence:CCGGTCGTGAGTAGTGGGCAAATAACTCGAGTTATTTGCCCACTACTCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-144s21c1
Sequence:CCGGGAGCAGACTTGGAGGTAACATCTCGAGATGTTACCTCCAAGTCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-240s21c1
Sequence:CCGGTCTGGATGCGAGCACCTACAACTCGAGTTGTAGGTGCTCGCATCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-188s21c1
Sequence:CCGGGTCCACTCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGAGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026784
VALIDATED
PMVK MISSION shRNA Lentiviral Transduction Particles
phosphomevalonate kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-429s21c1
Sequence:CCGGGATACAGACAGTCCGAGTAGTCTCGAGACTACTCGGACTGTCTGTATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-608s1c1
Sequence:CCGGCTGGGATTTATTCAAGCCAAACTCGAGTTTGGCTTGAATAAATCCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026784.1-389s1c1
Sequence:CCGGACATCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGATGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-554s1c1
Sequence:CCGGGTCATTGAGAACCACGGAGATCTCGAGATCTCCGTGGTTCTCAATGACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-90s1c1
Sequence:CCGGTGCTGTTTAGCGGGAAGAGAACTCGAGTTCTCTTCCCGCTAAACAGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026784.1-527s1c1
Sequence:CCGGCTGGACAACTTTGGGAACTTTCTCGAGAAAGTTCCCAAAGTTGTCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026784.2-769s21c1
Sequence:CCGGTCGTGAGTAGTGGGCAAATAACTCGAGTTATTTGCCCACTACTCACGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-144s21c1
Sequence:CCGGGAGCAGACTTGGAGGTAACATCTCGAGATGTTACCTCCAAGTCTGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-240s21c1
Sequence:CCGGTCTGGATGCGAGCACCTACAACTCGAGTTGTAGGTGCTCGCATCCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026784.2-188s21c1
Sequence:CCGGGTCCACTCAAGGAGGAGTATGCTCGAGCATACTCCTCCTTGAGTGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006556
VALIDATED
PMVK MISSION shRNA Bacterial Glycerol Stock
phosphomevalonate kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006556.2-351s1c1
Sequence:CCGGCGGCAAGAGGAAATCCGGGAACTCGAGTTCCCGGATTTCCTCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-442s1c1
Sequence:CCGGCCACTCAAGGAACAGTATGCTCTCGAGAGCATACTGTTCCTTGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1131s1c1
Sequence:CCGGGAAGGCGAAACCCTGCCATATCTCGAGATATGGCAGGGTTTCGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-850s1c1
Sequence:CCGGGAGAACCTGATAGAATTTATCCTCGAGGATAAATTCTATCAGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-640s1c1
Sequence:CCGGGTGTCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-810s1c1
Sequence:CCGGCGAGAACCATGGAGTTGAACACTCGAGTGTTCAACTCCATGGTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-795s1c1
Sequence:CCGGCTTTGACTGGGTCATCGAGAACTCGAGTTCTCGATGACCCAGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1183s1c1
Sequence:CCGGCCTTGCATCCTGACTGGATGTCTCGAGACATCCAGTCAGGATGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006556
VALIDATED
PMVK MISSION shRNA shRNA Plasmid DNA
phosphomevalonate kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006556.2-351s1c1
Sequence:CCGGCGGCAAGAGGAAATCCGGGAACTCGAGTTCCCGGATTTCCTCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-442s1c1
Sequence:CCGGCCACTCAAGGAACAGTATGCTCTCGAGAGCATACTGTTCCTTGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1131s1c1
Sequence:CCGGGAAGGCGAAACCCTGCCATATCTCGAGATATGGCAGGGTTTCGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-850s1c1
Sequence:CCGGGAGAACCTGATAGAATTTATCCTCGAGGATAAATTCTATCAGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-640s1c1
Sequence:CCGGGTGTCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-810s1c1
Sequence:CCGGCGAGAACCATGGAGTTGAACACTCGAGTGTTCAACTCCATGGTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-795s1c1
Sequence:CCGGCTTTGACTGGGTCATCGAGAACTCGAGTTCTCGATGACCCAGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1183s1c1
Sequence:CCGGCCTTGCATCCTGACTGGATGTCTCGAGACATCCAGTCAGGATGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006556
VALIDATED
PMVK MISSION shRNA Lentiviral Transduction Particles
phosphomevalonate kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006556.2-351s1c1
Sequence:CCGGCGGCAAGAGGAAATCCGGGAACTCGAGTTCCCGGATTTCCTCTTGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-442s1c1
Sequence:CCGGCCACTCAAGGAACAGTATGCTCTCGAGAGCATACTGTTCCTTGAGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1131s1c1
Sequence:CCGGGAAGGCGAAACCCTGCCATATCTCGAGATATGGCAGGGTTTCGCCTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-850s1c1
Sequence:CCGGGAGAACCTGATAGAATTTATCCTCGAGGATAAATTCTATCAGGTTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000010999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-640s1c1
Sequence:CCGGGTGTCTGACATCCAGTGGTTTCTCGAGAAACCACTGGATGTCAGACACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-810s1c1
Sequence:CCGGCGAGAACCATGGAGTTGAACACTCGAGTGTTCAACTCCATGGTTCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-795s1c1
Sequence:CCGGCTTTGACTGGGTCATCGAGAACTCGAGTTCTCGATGACCCAGTCAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000199399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006556.2-1183s1c1
Sequence:CCGGCCTTGCATCCTGACTGGATGTCTCGAGACATCCAGTCAGGATGCAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???