EMAIL THIS PAGE TO A FRIEND

PNCK

pregnancy up-regulated non-ubiquitously expressed CaM kinase

58 Gene Product Result for
Synonyms: BSTK3 CaMK1b
UniProtKB ID: Q6P2M8, B4DJR8, B4E1A6, B7WPG0, D3DWU7, Q8N4R0
Gene ID:
Human(139728) Summary: PNCK is a member of the calcium/calmodulin-dependent protein kinase family of protein serine/threonine kinases (see CAMK1; MIM 604998) (Gardner et al., 2000 [PubMed 10673339]
Mouse(93843) pregnancy upregulated non-ubiquitously expressed CaM kinase
Rat(29660) pregnancy upregulated non-ubiquitously expressed CaM kinase
Zebrafish(567480) pregnancy up-regulated non-ubiquitously expressed CaM kinase
domestic cat(101087718) pregnancy up-regulated non-ubiquitously expressed CaM kinase
dog(492241) pregnancy up-regulated non-ubiquitously expressed CaM kinase
cow(614251) pregnancy up-regulated non-ubiquitously expressed CaM kinase
sheep(101123191) pregnancy up-regulated non-ubiquitously expressed CaM kinase
domestic guinea pig(100713425) pregnancy up-regulated non-ubiquitously expressed CaM kinase
naked mole-rat(101717457) pregnancy up-regulated non-ubiquitously expressed CaM kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039582 Rosetta Predictions human pricing
NM_017275 Rosetta Predictions rat pricing
NM_012040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225454 predicted 503
2 SASI_Hs01_00225455 predicted 490
3 SASI_Hs01_00225456 predicted 784
4 SASI_Hs01_00225458 predicted 591
5 SASI_Hs01_00225459 predicted 490
6 SASI_Hs01_00225460 predicted 945
7 SASI_Hs01_00225461 predicted 937
8 SASI_Hs01_00225462 predicted 795
9 SASI_Hs01_00225463 predicted 510
10 SASI_Hs02_00308585 predicted 835
11 SASI_Hs01_00225457 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053504 predicted 247
2 SASI_Rn01_00053505 predicted 657
3 SASI_Rn01_00053506 predicted 1050
4 SASI_Rn01_00053507 predicted 1117
5 SASI_Rn01_00053508 predicted 495
6 SASI_Rn01_00053509 predicted 925
7 SASI_Rn01_00053510 predicted 394
8 SASI_Rn01_00053511 predicted 1108
9 SASI_Rn01_00053512 predicted 392
10 SASI_Rn01_00053513 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123602 predicted 1246
2 SASI_Mm01_00123603 predicted 1069
3 SASI_Mm01_00123604 predicted 550
4 SASI_Mm01_00123605 predicted 342
5 SASI_Mm01_00123606 predicted 1007
6 SASI_Mm01_00123608 predicted 998
7 SASI_Mm01_00123609 predicted 321
8 SASI_Mm01_00123610 predicted 1249
9 SASI_Mm01_00123611 predicted 831
10 SASI_Mm02_00322008 predicted 939
11 SASI_Mm01_00123607 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039582
PNCK MISSION shRNA Bacterial Glycerol Stock
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-873s21c1
Sequence:GTACCGGGCCCTTTGAGGACTCGAAGATCTCGAGATCTTCGAGTCCTCAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1259s21c1
Sequence:CCGGCCTTCGACAGGGACATCTTAGCTCGAGCTAAGATGTCCCTGTCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039582.3-1510s21c1
Sequence:CCGGTTCCTTCCCTTGGATGCTTTCCTCGAGGAAAGCATCCAAGGGAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1118s21c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-552s21c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1148s21c1
Sequence:GTACCGGACATCTCAGAATCAGCCAAAGCTCGAGCTTTGGCTGATTCTGAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-341s1c1
Sequence:CCGGGCGAGCTGTTTGACCGCATCACTCGAGTGATGCGGTCAAACAGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-988s1c1
Sequence:CCGGCGGAAGAACTTTGCTCGGACACTCGAGTGTCCGAGCAAAGTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039582
PNCK MISSION shRNA shRNA Plasmid DNA
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-873s21c1
Sequence:GTACCGGGCCCTTTGAGGACTCGAAGATCTCGAGATCTTCGAGTCCTCAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1259s21c1
Sequence:CCGGCCTTCGACAGGGACATCTTAGCTCGAGCTAAGATGTCCCTGTCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039582.3-1510s21c1
Sequence:CCGGTTCCTTCCCTTGGATGCTTTCCTCGAGGAAAGCATCCAAGGGAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1118s21c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-552s21c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1148s21c1
Sequence:GTACCGGACATCTCAGAATCAGCCAAAGCTCGAGCTTTGGCTGATTCTGAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-341s1c1
Sequence:CCGGGCGAGCTGTTTGACCGCATCACTCGAGTGATGCGGTCAAACAGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-988s1c1
Sequence:CCGGCGGAAGAACTTTGCTCGGACACTCGAGTGTCCGAGCAAAGTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039582
PNCK MISSION shRNA Lentiviral Transduction Particles
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-873s21c1
Sequence:GTACCGGGCCCTTTGAGGACTCGAAGATCTCGAGATCTTCGAGTCCTCAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1259s21c1
Sequence:CCGGCCTTCGACAGGGACATCTTAGCTCGAGCTAAGATGTCCCTGTCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039582.3-1510s21c1
Sequence:CCGGTTCCTTCCCTTGGATGCTTTCCTCGAGGAAAGCATCCAAGGGAAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1118s21c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-552s21c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039582.3-1148s21c1
Sequence:GTACCGGACATCTCAGAATCAGCCAAAGCTCGAGCTTTGGCTGATTCTGAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-341s1c1
Sequence:CCGGGCGAGCTGTTTGACCGCATCACTCGAGTGATGCGGTCAAACAGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039582.1-988s1c1
Sequence:CCGGCGGAAGAACTTTGCTCGGACACTCGAGTGTCCGAGCAAAGTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012040
PNCK MISSION shRNA Bacterial Glycerol Stock
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-288s21c1
Sequence:CCGGATCGCGGTACTTCGCAGAATCCTCGAGGATTCTGCGAAGTACCGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-470s21c1
Sequence:CCGGCGCTGTCTCCTACCTTCATAGCTCGAGCTATGAAGGTAGGAGACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-130s21c1
Sequence:CCGGAGGACATCAGCAGTGTCTATGCTCGAGCATAGACACTGCTGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-1002s21c1
Sequence:CCGGGCATTCAATGCCACATCATTCCTCGAGGAATGATGTGGCATTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-735s1c1
Sequence:CCGGCCCTTCTATGATGAGAGCGATCTCGAGATCGCTCTCATCATAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-756s1c1
Sequence:CCGGCCTGAACTCTTCAGCCAGATTCTCGAGAATCTGGCTGAAGAGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-279s1c1
Sequence:CCGGGAGAATGAGATCGCGGTACTTCTCGAGAAGTACCGCGATCTCATTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-846s1c1
Sequence:CCGGCGCCACCTTCTGGAACGTGATCTCGAGATCACGTTCCAGAAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-1000s1c1
Sequence:CCGGGTGCATTCAATGCCACATCATCTCGAGATGATGTGGCATTGAATGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012040
PNCK MISSION shRNA shRNA Plasmid DNA
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-288s21c1
Sequence:CCGGATCGCGGTACTTCGCAGAATCCTCGAGGATTCTGCGAAGTACCGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-470s21c1
Sequence:CCGGCGCTGTCTCCTACCTTCATAGCTCGAGCTATGAAGGTAGGAGACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-130s21c1
Sequence:CCGGAGGACATCAGCAGTGTCTATGCTCGAGCATAGACACTGCTGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-1002s21c1
Sequence:CCGGGCATTCAATGCCACATCATTCCTCGAGGAATGATGTGGCATTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-735s1c1
Sequence:CCGGCCCTTCTATGATGAGAGCGATCTCGAGATCGCTCTCATCATAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-756s1c1
Sequence:CCGGCCTGAACTCTTCAGCCAGATTCTCGAGAATCTGGCTGAAGAGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-279s1c1
Sequence:CCGGGAGAATGAGATCGCGGTACTTCTCGAGAAGTACCGCGATCTCATTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-846s1c1
Sequence:CCGGCGCCACCTTCTGGAACGTGATCTCGAGATCACGTTCCAGAAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-1000s1c1
Sequence:CCGGGTGCATTCAATGCCACATCATCTCGAGATGATGTGGCATTGAATGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012040
PNCK MISSION shRNA Lentiviral Transduction Particles
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-288s21c1
Sequence:CCGGATCGCGGTACTTCGCAGAATCCTCGAGGATTCTGCGAAGTACCGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-470s21c1
Sequence:CCGGCGCTGTCTCCTACCTTCATAGCTCGAGCTATGAAGGTAGGAGACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-130s21c1
Sequence:CCGGAGGACATCAGCAGTGTCTATGCTCGAGCATAGACACTGCTGATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012040.2-1002s21c1
Sequence:CCGGGCATTCAATGCCACATCATTCCTCGAGGAATGATGTGGCATTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-735s1c1
Sequence:CCGGCCCTTCTATGATGAGAGCGATCTCGAGATCGCTCTCATCATAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-756s1c1
Sequence:CCGGCCTGAACTCTTCAGCCAGATTCTCGAGAATCTGGCTGAAGAGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-279s1c1
Sequence:CCGGGAGAATGAGATCGCGGTACTTCTCGAGAAGTACCGCGATCTCATTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-846s1c1
Sequence:CCGGCGCCACCTTCTGGAACGTGATCTCGAGATCACGTTCCAGAAGGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012040.2-1000s1c1
Sequence:CCGGGTGCATTCAATGCCACATCATCTCGAGATGATGTGGCATTGAATGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198452
VALIDATED
PNCK MISSION shRNA Bacterial Glycerol Stock
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-1391s1c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198452.1-55s1c1
Sequence:CCGGCATCAGCAGCGTCTACGAGATCTCGAGATCTCGTAGACGCTGCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-229s1c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-295s1c1
Sequence:CCGGGATCGCAGTGCTCCGTAGGATCTCGAGATCCTACGGAGCACTGCGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_198452.1-352s1c1
Sequence:CCGGCGAGAGCCCTTCCCACCTCTACTCGAGTAGAGGTGGGAAGGGCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198452
VALIDATED
PNCK MISSION shRNA shRNA Plasmid DNA
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-1391s1c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198452.1-55s1c1
Sequence:CCGGCATCAGCAGCGTCTACGAGATCTCGAGATCTCGTAGACGCTGCTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-229s1c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-295s1c1
Sequence:CCGGGATCGCAGTGCTCCGTAGGATCTCGAGATCCTACGGAGCACTGCGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_198452.1-352s1c1
Sequence:CCGGCGAGAGCCCTTCCCACCTCTACTCGAGTAGAGGTGGGAAGGGCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198452
VALIDATED
PNCK MISSION shRNA Lentiviral Transduction Particles
pregnancy up-regulated non-ubiquitously expressed CaM kinase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-1391s1c1
Sequence:CCGGGCTATGAGTTTGACTCTCCTTCTCGAGAAGGAGAGTCAAACTCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198452.1-55s1c1
Sequence:CCGGCATCAGCAGCGTCTACGAGATCTCGAGATCTCGTAGACGCTGCTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-229s1c1
Sequence:CCGGCCTCGTGGCCCTCAAGTGCATCTCGAGATGCACTTGAGGGCCACGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_198452.1-295s1c1
Sequence:CCGGGATCGCAGTGCTCCGTAGGATCTCGAGATCCTACGGAGCACTGCGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_198452.1-352s1c1
Sequence:CCGGCGAGAGCCCTTCCCACCTCTACTCGAGTAGAGGTGGGAAGGGCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)