EMAIL THIS PAGE TO A FRIEND

PNISR

PNN-interacting serine/arginine-rich protein

240 Gene Product Result for
Synonyms: C6orf111 HSPC306 RP11-98I9.2 SFRS18 SRrp130 bA98I9.2
Gene ID:
Rat(297942) PNN-interacting serine/arginine-rich protein
sheep(101103575) PNN-interacting serine/arginine-rich protein
naked mole-rat(101713777) PNN-interacting serine/arginine-rich protein
domestic guinea pig(100724834) PNN-interacting serine/arginine-rich protein
Zebrafish(563938) PNN-interacting serine/arginine-rich protein
chicken(421796) PNN-interacting serine/arginine-rich protein
domestic cat(101084965) PNN-interacting serine/arginine-rich protein
dog(475005) PNN-interacting serine/arginine-rich protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032870 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074761 MISSION® esiRNA esiRNA human SFRS18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015491 Rosetta Predictions human pricing
NM_032870 Rosetta Predictions human pricing
NM_001025274 Rosetta Predictions rat pricing
XM_001055451 Rosetta Predictions rat pricing
XM_001055505 Rosetta Predictions rat pricing
XM_001055560 Rosetta Predictions rat pricing
XM_001060221 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347953 predicted 675
2 SASI_Hs02_00347954 predicted 1234
3 SASI_Hs02_00347955 predicted 1329
4 SASI_Hs02_00347956 predicted 1311
5 SASI_Hs02_00347957 predicted 329
6 SASI_Hs02_00347958 predicted 1345
7 SASI_Hs02_00347959 predicted 365
8 SASI_Hs02_00347960 predicted 568
9 SASI_Hs02_00347961 predicted 674
10 SASI_Hs02_00347962 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108905 predicted 757
2 SASI_Hs01_00108906 predicted 1313
3 SASI_Hs01_00108907 predicted 1414
4 SASI_Hs01_00108908 predicted 1388
5 SASI_Hs01_00108909 predicted 414
6 SASI_Hs01_00108910 predicted 1429
7 SASI_Hs01_00108911 predicted 440
8 SASI_Hs01_00108912 predicted 655
9 SASI_Hs01_00108913 predicted 753
10 SASI_Hs01_00108914 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203090 predicted 1089
2 SASI_Rn02_00203091 predicted 739
3 SASI_Rn02_00203092 predicted 367
4 SASI_Rn02_00203093 predicted 848
5 SASI_Rn02_00203094 predicted 1270
6 SASI_Rn02_00203095 predicted 1288
7 SASI_Rn02_00203096 predicted 1900
8 SASI_Rn02_00203097 predicted 771
9 SASI_Rn02_00203098 predicted 739
10 SASI_Rn02_00203099 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279562 predicted 858
2 SASI_Rn02_00279563 predicted 500
3 SASI_Rn02_00279564 predicted 613
4 SASI_Rn02_00279565 predicted 1030
5 SASI_Rn02_00279566 predicted 1058
6 SASI_Rn02_00279567 predicted 1672
7 SASI_Rn02_00279568 predicted 536
8 SASI_Rn02_00279569 predicted 497
9 SASI_Rn02_00279570 predicted 309
10 SASI_Rn02_00279571 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279771 predicted 1083
2 SASI_Rn02_00279772 predicted 720
3 SASI_Rn02_00279773 predicted 348
4 SASI_Rn02_00279774 predicted 840
5 SASI_Rn02_00279775 predicted 1256
6 SASI_Rn02_00279776 predicted 1280
7 SASI_Rn02_00279777 predicted 1894
8 SASI_Rn02_00279778 predicted 754
9 SASI_Rn02_00279779 predicted 726
10 SASI_Rn02_00279780 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280029 predicted 1103
2 SASI_Rn02_00280030 predicted 753
3 SASI_Rn02_00280031 predicted 1284
4 SASI_Rn02_00280032 predicted 1300
5 SASI_Rn02_00280033 predicted 1455
6 SASI_Rn02_00280034 predicted 1922
7 SASI_Rn02_00280035 predicted 1485
8 SASI_Rn02_00280036 predicted 781
9 SASI_Rn02_00280037 predicted 2448
10 SASI_Rn02_00280038 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295762 predicted 1878
2 SASI_Rn02_00295763 predicted 1919
3 SASI_Rn02_00295764 predicted 1483
4 SASI_Rn02_00295765 predicted 1839
5 SASI_Rn02_00295766 predicted 1886
6 SASI_Rn02_00295767 predicted 1838
7 SASI_Rn02_00295768 predicted 1964
8 SASI_Rn02_00295769 predicted 1658
9 SASI_Rn02_00295770 predicted 1930
10 SASI_Rn02_00295771 predicted 1576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032870
PNISR MISSION shRNA Bacterial Glycerol Stock
PNN-interacting serine/arginine-rich protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1452s1c1
Sequence:CCGGGCAGACGGTGATGTGGTTAATCTCGAGATTAACCACATCACCGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-509s1c1
Sequence:CCGGGCCAGTGAACCAGTTTGACTACTCGAGTAGTCAAACTGGTTCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1648s1c1
Sequence:CCGGGCTCAGGTAGTAGTCGTACTTCTCGAGAAGTACGACTACTACCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1651s1c1
Sequence:CCGGCAGGTAGTAGTCGTACTTCTTCTCGAGAAGAAGTACGACTACTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-891s21c1
Sequence:CCGGTCCACAAATTGACGCAGTAAACTCGAGTTTACTGCGTCAATTTGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-80s1c1
Sequence:CCGGGCAACAATGGATGCAGTCATTCTCGAGAATGACTGCATCCATTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1455s1c1
Sequence:CCGGGACGGTGATGTGGTTAATGAACTCGAGTTCATTAACCACATCACCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-510s1c1
Sequence:CCGGCCAGTGAACCAGTTTGACTATCTCGAGATAGTCAAACTGGTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1561s1c1
Sequence:CCGGCGGGAAGTTCTAGTAGTGGTACTCGAGTACCACTACTAGAACTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-2630s21c1
Sequence:CCGGAGTCCCGATCAAGGTAGTATACTCGAGTATACTACCTTGATCGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032870
PNISR MISSION shRNA shRNA Plasmid DNA
PNN-interacting serine/arginine-rich protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1452s1c1
Sequence:CCGGGCAGACGGTGATGTGGTTAATCTCGAGATTAACCACATCACCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-509s1c1
Sequence:CCGGGCCAGTGAACCAGTTTGACTACTCGAGTAGTCAAACTGGTTCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1648s1c1
Sequence:CCGGGCTCAGGTAGTAGTCGTACTTCTCGAGAAGTACGACTACTACCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1651s1c1
Sequence:CCGGCAGGTAGTAGTCGTACTTCTTCTCGAGAAGAAGTACGACTACTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-891s21c1
Sequence:CCGGTCCACAAATTGACGCAGTAAACTCGAGTTTACTGCGTCAATTTGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-80s1c1
Sequence:CCGGGCAACAATGGATGCAGTCATTCTCGAGAATGACTGCATCCATTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1455s1c1
Sequence:CCGGGACGGTGATGTGGTTAATGAACTCGAGTTCATTAACCACATCACCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-510s1c1
Sequence:CCGGCCAGTGAACCAGTTTGACTATCTCGAGATAGTCAAACTGGTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1561s1c1
Sequence:CCGGCGGGAAGTTCTAGTAGTGGTACTCGAGTACCACTACTAGAACTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-2630s21c1
Sequence:CCGGAGTCCCGATCAAGGTAGTATACTCGAGTATACTACCTTGATCGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032870
PNISR MISSION shRNA Lentiviral Transduction Particles
PNN-interacting serine/arginine-rich protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1452s1c1
Sequence:CCGGGCAGACGGTGATGTGGTTAATCTCGAGATTAACCACATCACCGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-509s1c1
Sequence:CCGGGCCAGTGAACCAGTTTGACTACTCGAGTAGTCAAACTGGTTCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1648s1c1
Sequence:CCGGGCTCAGGTAGTAGTCGTACTTCTCGAGAAGTACGACTACTACCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1651s1c1
Sequence:CCGGCAGGTAGTAGTCGTACTTCTTCTCGAGAAGAAGTACGACTACTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-891s21c1
Sequence:CCGGTCCACAAATTGACGCAGTAAACTCGAGTTTACTGCGTCAATTTGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-80s1c1
Sequence:CCGGGCAACAATGGATGCAGTCATTCTCGAGAATGACTGCATCCATTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1455s1c1
Sequence:CCGGGACGGTGATGTGGTTAATGAACTCGAGTTCATTAACCACATCACCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-510s1c1
Sequence:CCGGCCAGTGAACCAGTTTGACTATCTCGAGATAGTCAAACTGGTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032870.1-1561s1c1
Sequence:CCGGCGGGAAGTTCTAGTAGTGGTACTCGAGTACCACTACTAGAACTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032870.2-2630s21c1
Sequence:CCGGAGTCCCGATCAAGGTAGTATACTCGAGTATACTACCTTGATCGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)