EMAIL THIS PAGE TO A FRIEND

PNKD

paroxysmal nonkinesigenic dyskinesia

207 Gene Product Result for
Synonyms: BRP17 DYT8 FPD1 KIPP1184 MR-1 MR1 PDC PKND1 TAHCCP2
Gene ID:
Human(25953) Summary: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(56695) paroxysmal nonkinesiogenic dyskinesia
Rat(100188944) paroxysmal nonkinesigenic dyskinesia
Zebrafish(497562) paroxysmal nonkinesigenic dyskinesia
Horse(100055676) paroxysmal nonkinesigenic dyskinesia
domestic cat(101086413) paroxysmal nonkinesigenic dyskinesia
chicken(426214) paroxysmal nonkinesigenic dyskinesia
dog(610423) paroxysmal nonkinesigenic dyskinesia
domestic guinea pig(100722586) paroxysmal nonkinesigenic dyskinesia
naked mole-rat(101709120) paroxysmal nonkinesigenic dyskinesia
cow(616561) paroxysmal nonkinesigenic dyskinesia
sheep(101109335) paroxysmal nonkinesigenic dyskinesia
Goat(100861377) paroxysmal nonkinesigenic dyskinesia
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077399 Rosetta Predictions human pricing
NM_015488 Rosetta Predictions human pricing
NM_022572 Rosetta Predictions human pricing
NM_001134750 Rosetta Predictions rat pricing
NM_001134751 Rosetta Predictions rat pricing
NM_001134753 Rosetta Predictions rat pricing
NM_001039509 Rosetta Predictions mouse pricing
NM_019999 Rosetta Predictions mouse pricing
NM_025580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312464 predicted 227
2 SASI_Hs02_00312465 predicted 228
3 SASI_Hs02_00312466 predicted 386
4 SASI_Hs02_00312467 predicted 460
5 SASI_Hs02_00312468 predicted 460
6 SASI_Hs02_00312469 predicted 449
7 SASI_Hs02_00312470 predicted 253
8 SASI_Hs02_00312471 predicted 428
9 SASI_Hs02_00312472 predicted 207
10 SASI_Hs02_00312473 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347948 predicted 1751
2 SASI_Hs01_00214378 predicted 594
3 SASI_Hs02_00347949 predicted 1454
4 SASI_Hs01_00214381 predicted 577
5 SASI_Hs01_00214382 predicted 1009
6 SASI_Hs01_00214383 predicted 1441
7 SASI_Hs02_00347950 predicted 1631
8 SASI_Hs01_00214384 predicted 717
9 SASI_Hs01_00214387 predicted 704
10 SASI_Hs02_00347951 predicted 634
11 SASI_Hs01_00214379 predicted 740
12 SASI_Hs01_00214380 predicted 946
13 SASI_Hs01_00214385 predicted 702
14 SASI_Hs01_00214386 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355864 predicted 1601
2 SASI_Hs01_00130841 predicted 451
3 SASI_Hs02_00355865 predicted 1307
4 SASI_Hs01_00130844 predicted 440
5 SASI_Hs01_00130845 predicted 859
6 SASI_Hs01_00130846 predicted 1296
7 SASI_Hs02_00355866 predicted 1487
8 SASI_Hs01_00130847 predicted 568
9 SASI_Hs01_00130850 predicted 562
10 SASI_Hs02_00355867 predicted 489
11 SASI_Hs01_00130842 predicted 628
12 SASI_Hs01_00130843 predicted 828
13 SASI_Hs01_00130848 predicted 582
14 SASI_Hs01_00130849 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258344 predicted 1215
2 SASI_Rn02_00258345 predicted 464
3 SASI_Rn02_00258346 predicted 1133
4 SASI_Rn02_00258347 predicted 916
5 SASI_Rn02_00258348 predicted 1359
6 SASI_Rn02_00258349 predicted 574
7 SASI_Rn02_00258350 predicted 1011
8 SASI_Rn02_00258351 predicted 833
9 SASI_Rn02_00258352 predicted 1021
10 SASI_Rn02_00258353 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258354 predicted 1124
2 SASI_Rn02_00258355 predicted 381
3 SASI_Rn02_00258356 predicted 1045
4 SASI_Rn02_00258357 predicted 836
5 SASI_Rn02_00258358 predicted 1277
6 SASI_Rn02_00258359 predicted 497
7 SASI_Rn02_00258360 predicted 930
8 SASI_Rn02_00258361 predicted 745
9 SASI_Rn02_00258362 predicted 943
10 SASI_Rn02_00258363 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258364 predicted 307
2 SASI_Rn02_00258365 predicted 333
3 SASI_Rn02_00258366 predicted 342
4 SASI_Rn02_00258367 predicted 335
5 SASI_Rn02_00258368 predicted 318
6 SASI_Rn02_00258369 predicted 324
7 SASI_Rn02_00258370 predicted 214
8 SASI_Rn02_00258371 predicted 326
9 SASI_Rn02_00258372 predicted 227
10 SASI_Rn02_00258373 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290094 predicted 533
2 SASI_Mm01_00025618 predicted 953
3 SASI_Mm01_00025621 predicted 956
4 SASI_Mm01_00025622 predicted 1599
5 SASI_Mm01_00025623 predicted 610
6 SASI_Mm01_00025624 predicted 1512
7 SASI_Mm01_00025625 predicted 973
8 SASI_Mm01_00025626 predicted 595
9 SASI_Mm01_00025627 predicted 1003
10 SASI_Mm02_00290095 predicted 685
11 SASI_Mm01_00025619 predicted 491
12 SASI_Mm01_00025620 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325346 predicted 440
2 SASI_Mm01_00177398 predicted 860
3 SASI_Mm02_00325347 predicted 1434
4 SASI_Mm01_00177401 predicted 866
5 SASI_Mm01_00177402 predicted 1505
6 SASI_Mm01_00177403 predicted 512
7 SASI_Mm01_00177404 predicted 1418
8 SASI_Mm01_00177405 predicted 874
9 SASI_Mm01_00177406 predicted 504
10 SASI_Mm01_00177407 predicted 916
11 SASI_Mm01_00177399 predicted 401
12 SASI_Mm01_00177400 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068425 predicted 339
2 SASI_Mm01_00068426 predicted 376
3 SASI_Mm01_00068427 predicted 384
4 SASI_Mm01_00068428 predicted 347
5 SASI_Mm01_00068429 predicted 357
6 SASI_Mm01_00068430 predicted 368
7 SASI_Mm01_00068431 predicted 205
8 SASI_Mm01_00068432 predicted 376
9 SASI_Mm01_00068433 predicted 371
10 SASI_Mm01_00068434 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015488
PNKD MISSION shRNA Bacterial Glycerol Stock
paroxysmal nonkinesigenic dyskinesia
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-1004s21c1
Sequence:CCGGTGTGGCCTGGTCATGAGTATGCTCGAGCATACTCATGACCAGGCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-1180s1c1
Sequence:CCGGGAAGGATATGCACAAGAGCAACTCGAGTTGCTCTTGTGCATATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015488.3-2210s1c1
Sequence:CCGGCCAGCCATATTCCCATGTGATCTCGAGATCACATGGGAATATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-385s1c1
Sequence:CCGGCCGCCTCTTCAATGGAGTGAACTCGAGTTCACTCCATTGAAGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-222s1c1
Sequence:CCGGAGCTGGAATACATTCCCAGAACTCGAGTTCTGGGAATGTATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-131s1c1
Sequence:CCGGACAGCTAACAAGGTTTCTCATCTCGAGATGAGAAACCTTGTTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1366s21c1
Sequence:CCGGATCATCCTTCTCATCGCTAACCTCGAGGTTAGCGATGAGAAGGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1750s21c1
Sequence:CCGGCTCAAGTGTGATGCCTTACAACTCGAGTTGTAAGGCATCACACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-231s21c1
Sequence:CCGGAGCTAACAAGGCTTCTCATAACTCGAGTTATGAGAAGCCTTGTTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015488
PNKD MISSION shRNA shRNA Plasmid DNA
paroxysmal nonkinesigenic dyskinesia
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-1004s21c1
Sequence:CCGGTGTGGCCTGGTCATGAGTATGCTCGAGCATACTCATGACCAGGCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-1180s1c1
Sequence:CCGGGAAGGATATGCACAAGAGCAACTCGAGTTGCTCTTGTGCATATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015488.3-2210s1c1
Sequence:CCGGCCAGCCATATTCCCATGTGATCTCGAGATCACATGGGAATATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-385s1c1
Sequence:CCGGCCGCCTCTTCAATGGAGTGAACTCGAGTTCACTCCATTGAAGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-222s1c1
Sequence:CCGGAGCTGGAATACATTCCCAGAACTCGAGTTCTGGGAATGTATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-131s1c1
Sequence:CCGGACAGCTAACAAGGTTTCTCATCTCGAGATGAGAAACCTTGTTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1366s21c1
Sequence:CCGGATCATCCTTCTCATCGCTAACCTCGAGGTTAGCGATGAGAAGGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1750s21c1
Sequence:CCGGCTCAAGTGTGATGCCTTACAACTCGAGTTGTAAGGCATCACACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-231s21c1
Sequence:CCGGAGCTAACAAGGCTTCTCATAACTCGAGTTATGAGAAGCCTTGTTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015488
PNKD MISSION shRNA Lentiviral Transduction Particles
paroxysmal nonkinesigenic dyskinesia
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-1004s21c1
Sequence:CCGGTGTGGCCTGGTCATGAGTATGCTCGAGCATACTCATGACCAGGCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-1180s1c1
Sequence:CCGGGAAGGATATGCACAAGAGCAACTCGAGTTGCTCTTGTGCATATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015488.3-2210s1c1
Sequence:CCGGCCAGCCATATTCCCATGTGATCTCGAGATCACATGGGAATATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-385s1c1
Sequence:CCGGCCGCCTCTTCAATGGAGTGAACTCGAGTTCACTCCATTGAAGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-222s1c1
Sequence:CCGGAGCTGGAATACATTCCCAGAACTCGAGTTCTGGGAATGTATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015488.3-131s1c1
Sequence:CCGGACAGCTAACAAGGTTTCTCATCTCGAGATGAGAAACCTTGTTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1366s21c1
Sequence:CCGGATCATCCTTCTCATCGCTAACCTCGAGGTTAGCGATGAGAAGGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015488.4-1750s21c1
Sequence:CCGGCTCAAGTGTGATGCCTTACAACTCGAGTTGTAAGGCATCACACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015488.4-231s21c1
Sequence:CCGGAGCTAACAAGGCTTCTCATAACTCGAGTTATGAGAAGCCTTGTTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025580
VALIDATED
PNKD MISSION shRNA Bacterial Glycerol Stock
paroxysmal nonkinesigenic dyskinesia
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-336s21c1
Sequence:CCGGACCGATTGAAGCAGATGAAAGCTCGAGCTTTCATCTGCTTCAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-323s21c1
Sequence:CCGGGAAGTGGACAAGGACCGATTGCTCGAGCAATCGGTCCTTGTCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-375s21c1
Sequence:CCGGTGTCCAACACGGGCGAGTATGCTCGAGCATACTCGCCCGTGTTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025580.2-467s21c1
Sequence:CCGGGTGAGGATCACTGCAACCTTGCTCGAGCAAGGTTGCAGTGATCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025580.1-583s1c1
Sequence:CCGGGCAACCTTGTGCTAGACTATTCTCGAGAATAGTCTAGCACAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-318s1c1
Sequence:CCGGGCTAGAATACATTCCCAGAAACTCGAGTTTCTGGGAATGTATTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-450s1c1
Sequence:CCGGGCAGATGAAAGCTCGTCAGAACTCGAGTTCTGACGAGCTTTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-270s1c1
Sequence:CCGGCCACAGCTCACCAGAATGCAACTCGAGTTGCATTCTGGTGAGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-435s1c1
Sequence:CCGGCAAGGACCGATTGAAGCAGATCTCGAGATCTGCTTCAATCGGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-112s21c1
Sequence:CCGGCTCTGGAGCCACAGCTAACAACTCGAGTTGTTAGCTGTGGCTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025580
VALIDATED
PNKD MISSION shRNA shRNA Plasmid DNA
paroxysmal nonkinesigenic dyskinesia
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-336s21c1
Sequence:CCGGACCGATTGAAGCAGATGAAAGCTCGAGCTTTCATCTGCTTCAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-323s21c1
Sequence:CCGGGAAGTGGACAAGGACCGATTGCTCGAGCAATCGGTCCTTGTCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-375s21c1
Sequence:CCGGTGTCCAACACGGGCGAGTATGCTCGAGCATACTCGCCCGTGTTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025580.2-467s21c1
Sequence:CCGGGTGAGGATCACTGCAACCTTGCTCGAGCAAGGTTGCAGTGATCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025580.1-583s1c1
Sequence:CCGGGCAACCTTGTGCTAGACTATTCTCGAGAATAGTCTAGCACAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-318s1c1
Sequence:CCGGGCTAGAATACATTCCCAGAAACTCGAGTTTCTGGGAATGTATTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-450s1c1
Sequence:CCGGGCAGATGAAAGCTCGTCAGAACTCGAGTTCTGACGAGCTTTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-270s1c1
Sequence:CCGGCCACAGCTCACCAGAATGCAACTCGAGTTGCATTCTGGTGAGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-435s1c1
Sequence:CCGGCAAGGACCGATTGAAGCAGATCTCGAGATCTGCTTCAATCGGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-112s21c1
Sequence:CCGGCTCTGGAGCCACAGCTAACAACTCGAGTTGTTAGCTGTGGCTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025580
VALIDATED
PNKD MISSION shRNA Lentiviral Transduction Particles
paroxysmal nonkinesigenic dyskinesia
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-336s21c1
Sequence:CCGGACCGATTGAAGCAGATGAAAGCTCGAGCTTTCATCTGCTTCAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-323s21c1
Sequence:CCGGGAAGTGGACAAGGACCGATTGCTCGAGCAATCGGTCCTTGTCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-375s21c1
Sequence:CCGGTGTCCAACACGGGCGAGTATGCTCGAGCATACTCGCCCGTGTTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025580.2-467s21c1
Sequence:CCGGGTGAGGATCACTGCAACCTTGCTCGAGCAAGGTTGCAGTGATCCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025580.1-583s1c1
Sequence:CCGGGCAACCTTGTGCTAGACTATTCTCGAGAATAGTCTAGCACAAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-318s1c1
Sequence:CCGGGCTAGAATACATTCCCAGAAACTCGAGTTTCTGGGAATGTATTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-450s1c1
Sequence:CCGGGCAGATGAAAGCTCGTCAGAACTCGAGTTCTGACGAGCTTTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-270s1c1
Sequence:CCGGCCACAGCTCACCAGAATGCAACTCGAGTTGCATTCTGGTGAGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025580.1-435s1c1
Sequence:CCGGCAAGGACCGATTGAAGCAGATCTCGAGATCTGCTTCAATCGGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025580.2-112s21c1
Sequence:CCGGCTCTGGAGCCACAGCTAACAACTCGAGTTGTTAGCTGTGGCTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)