EMAIL THIS PAGE TO A FRIEND

PNKP

polynucleotide kinase 3'-phosphatase

65 Gene Product Result for
Synonyms: EIEE10 MCSZ PNK
UniProtKB ID: Q96T60, Q9P1V2, Q9UKU8, Q9UNF8, Q9UNI0
Gene ID:
Human(11284) Summary: This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay.[provided by RefSeq, Sep 2010]
Mouse(59047) polynucleotide kinase 3'- phosphatase
Rat(308576) polynucleotide kinase 3'-phosphatase
Zebrafish(569462) polynucleotide kinase 3'-phosphatase
Horse(100052218) polynucleotide kinase 3'-phosphatase
domestic cat(101093816) polynucleotide kinase 3'-phosphatase
dog(484373) polynucleotide kinase 3'-phosphatase
cow(616621) polynucleotide kinase 3'-phosphatase
sheep(101114209) polynucleotide kinase 3'-phosphatase
naked mole-rat(101712591) polynucleotide kinase 3'-phosphatase
domestic guinea pig(100722607) polynucleotide kinase 3'-phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007254 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132321 MISSION® esiRNA esiRNA human PNKP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007254 Rosetta Predictions human pricing
NM_001004259 Rosetta Predictions rat pricing
NM_021549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067475 predicted 507
2 SASI_Hs01_00067476 predicted 1227
3 SASI_Hs01_00067477 predicted 920
4 SASI_Hs01_00067478 predicted 674
5 SASI_Hs01_00067479 predicted 1233
6 SASI_Hs01_00067480 predicted 401
7 SASI_Hs01_00067481 predicted 1487
8 SASI_Hs01_00067482 predicted 230
9 SASI_Hs01_00067483 predicted 673
10 SASI_Hs01_00067484 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055178 predicted 984
2 SASI_Rn01_00055179 predicted 1208
3 SASI_Rn01_00055180 predicted 449
4 SASI_Rn01_00055181 predicted 629
5 SASI_Rn01_00055182 predicted 1024
6 SASI_Rn01_00055183 predicted 820
7 SASI_Rn01_00055184 predicted 249
8 SASI_Rn01_00055185 predicted 1153
9 SASI_Rn01_00055187 predicted 1064
10 SASI_Rn02_00198279 predicted 1112
11 SASI_Rn01_00055186 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326307 predicted 854
2 SASI_Mm02_00326308 predicted 791
3 SASI_Mm02_00326309 predicted 346
4 SASI_Mm01_00075970 predicted 1365
5 SASI_Mm01_00075971 predicted 420
6 SASI_Mm01_00075973 predicted 466
7 SASI_Mm02_00326310 predicted 1635
8 SASI_Mm01_00075975 predicted 450
9 SASI_Mm01_00075976 predicted 626
10 SASI_Mm02_00326311 predicted 1513
11 SASI_Mm01_00075972 predicted 1254
12 SASI_Mm01_00075974 predicted 557
13 SASI_Mm01_00075977 predicted 270
14 SASI_Mm01_00075978 predicted 540
15 SASI_Mm01_00075979 predicted 1166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021549
VALIDATED
PNKP MISSION shRNA Bacterial Glycerol Stock
polynucleotide kinase 3'-phosphatase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-552s1c1
Sequence:CCGGGTTGGTAATCTTCAACCAAATCTCGAGATTTGGTTGAAGATTACCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1333s1c1
Sequence:CCGGGTGTCGGACATGGTCATGTTTCTCGAGAAACATGACCATGTCCGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-412s1c1
Sequence:CCGGCGAGTTCGGAAATCCTCTCTTCTCGAGAAGAGAGGATTTCCGAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1250s1c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-142s1c1
Sequence:CCGGCGAAACCAAGTGGAGCTGATTCTCGAGAATCAGCTCCACTTGGTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-503s21c1
Sequence:CCGGTATCTGGTTAATGGCCTATATCTCGAGATATAGGCCATTAACCAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021549.2-1892s21c1
Sequence:CCGGCCAAGTGGGCTCTTGTGTATCCTCGAGGATACACAAGAGCCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-1557s21c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-412s21c1
Sequence:CCGGAGTGAAACAGCTGGGTGTTAACTCGAGTTAACACCCAGCTGTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-973s21c1
Sequence:CCGGGGCAACACATGCAGGTCTAAACTCGAGTTTAGACCTGCATGTGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021549
VALIDATED
PNKP MISSION shRNA shRNA Plasmid DNA
polynucleotide kinase 3'-phosphatase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-552s1c1
Sequence:CCGGGTTGGTAATCTTCAACCAAATCTCGAGATTTGGTTGAAGATTACCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1333s1c1
Sequence:CCGGGTGTCGGACATGGTCATGTTTCTCGAGAAACATGACCATGTCCGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-412s1c1
Sequence:CCGGCGAGTTCGGAAATCCTCTCTTCTCGAGAAGAGAGGATTTCCGAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1250s1c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-142s1c1
Sequence:CCGGCGAAACCAAGTGGAGCTGATTCTCGAGAATCAGCTCCACTTGGTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-503s21c1
Sequence:CCGGTATCTGGTTAATGGCCTATATCTCGAGATATAGGCCATTAACCAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021549.2-1892s21c1
Sequence:CCGGCCAAGTGGGCTCTTGTGTATCCTCGAGGATACACAAGAGCCCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-1557s21c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-412s21c1
Sequence:CCGGAGTGAAACAGCTGGGTGTTAACTCGAGTTAACACCCAGCTGTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-973s21c1
Sequence:CCGGGGCAACACATGCAGGTCTAAACTCGAGTTTAGACCTGCATGTGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021549
VALIDATED
PNKP MISSION shRNA Lentiviral Transduction Particles
polynucleotide kinase 3'-phosphatase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-552s1c1
Sequence:CCGGGTTGGTAATCTTCAACCAAATCTCGAGATTTGGTTGAAGATTACCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1333s1c1
Sequence:CCGGGTGTCGGACATGGTCATGTTTCTCGAGAAACATGACCATGTCCGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-412s1c1
Sequence:CCGGCGAGTTCGGAAATCCTCTCTTCTCGAGAAGAGAGGATTTCCGAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021549.1-1250s1c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021549.1-142s1c1
Sequence:CCGGCGAAACCAAGTGGAGCTGATTCTCGAGAATCAGCTCCACTTGGTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-503s21c1
Sequence:CCGGTATCTGGTTAATGGCCTATATCTCGAGATATAGGCCATTAACCAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021549.2-1892s21c1
Sequence:CCGGCCAAGTGGGCTCTTGTGTATCCTCGAGGATACACAAGAGCCCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-1557s21c1
Sequence:CCGGGCTGTTTCAACTTCTGTGCTACTCGAGTAGCACAGAAGTTGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-412s21c1
Sequence:CCGGAGTGAAACAGCTGGGTGTTAACTCGAGTTAACACCCAGCTGTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021549.2-973s21c1
Sequence:CCGGGGCAACACATGCAGGTCTAAACTCGAGTTTAGACCTGCATGTGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007254
VALIDATED
PNKP MISSION shRNA Bacterial Glycerol Stock
polynucleotide kinase 3'-phosphatase
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-377s1c1
Sequence:CCGGGACACACTGTATTTGGTCAATCTCGAGATTGACCAAATACAGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-553s1c1
Sequence:CCGGCTTGGAGAAGTTGCTAGTGTTCTCGAGAACACTAGCAACTTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-517s1c1
Sequence:CCGGGAAGCGTATGCGGAAGTCAAACTCGAGTTTGACTTCCGCATACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007254.2-1543s1c1
Sequence:CCGGGTATGGCTACAGGAAGCAGTTCTCGAGAACTGCTTCCTGTAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-1526s1c1
Sequence:CCGGGTGTCAGACATGGTCATGTATCTCGAGATACATGACCATGTCTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-734s21c1
Sequence:CCGGGGCTACAAGCTGGTGATCTTCCTCGAGGAAGATCACCAGCTTGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-236s21c1
Sequence:CCGGCGGAAGTGCTCCAGAACTCAACTCGAGTTGAGTTCTGGAGCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1272s21c1
Sequence:CCGGCCGGATATGTCCACGTGAACACTCGAGTGTTCACGTGGACATATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-672s21c1
Sequence:CCGGCCAGTGACTGGAGGATCTTGTCTCGAGACAAGATCCTCCAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-642s21c1
Sequence:CCGGCACGCTCTGGGAAGGTCTTTCCTCGAGGAAAGACCTTCCCAGAGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1112s21c1
Sequence:CCGGTTCGAGCTCCCAGCCTTTGATCTCGAGATCAAAGGCTGGGAGCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-441s21c1
Sequence:CCGGCAGAATCCCAGCCAGATACTCCTCGAGGAGTATCTGGCTGGGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1527s21c1
Sequence:CCGGTGTCAGACATGGTCATGTATGCTCGAGCATACATGACCATGTCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1501s21c1
Sequence:CCGGGATGACGGACTCCTCTCATATCTCGAGATATGAGAGGAGTCCGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1361s21c1
Sequence:CCGGGTCGCCATCGACAACACAAACCTCGAGGTTTGTGTTGTCGATGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-378s21c1
Sequence:CCGGACACACTGTATTTGGTCAATGCTCGAGCATTGACCAAATACAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007254.2-295s21c1
Sequence:CCGGAGTGAAACAGCTGGGAGTTAACTCGAGTTAACTCCCAGCTGTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007254
VALIDATED
PNKP MISSION shRNA shRNA Plasmid DNA
polynucleotide kinase 3'-phosphatase
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-377s1c1
Sequence:CCGGGACACACTGTATTTGGTCAATCTCGAGATTGACCAAATACAGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-553s1c1
Sequence:CCGGCTTGGAGAAGTTGCTAGTGTTCTCGAGAACACTAGCAACTTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-517s1c1
Sequence:CCGGGAAGCGTATGCGGAAGTCAAACTCGAGTTTGACTTCCGCATACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007254.2-1543s1c1
Sequence:CCGGGTATGGCTACAGGAAGCAGTTCTCGAGAACTGCTTCCTGTAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-1526s1c1
Sequence:CCGGGTGTCAGACATGGTCATGTATCTCGAGATACATGACCATGTCTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-734s21c1
Sequence:CCGGGGCTACAAGCTGGTGATCTTCCTCGAGGAAGATCACCAGCTTGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-236s21c1
Sequence:CCGGCGGAAGTGCTCCAGAACTCAACTCGAGTTGAGTTCTGGAGCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1272s21c1
Sequence:CCGGCCGGATATGTCCACGTGAACACTCGAGTGTTCACGTGGACATATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-672s21c1
Sequence:CCGGCCAGTGACTGGAGGATCTTGTCTCGAGACAAGATCCTCCAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-642s21c1
Sequence:CCGGCACGCTCTGGGAAGGTCTTTCCTCGAGGAAAGACCTTCCCAGAGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1112s21c1
Sequence:CCGGTTCGAGCTCCCAGCCTTTGATCTCGAGATCAAAGGCTGGGAGCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-441s21c1
Sequence:CCGGCAGAATCCCAGCCAGATACTCCTCGAGGAGTATCTGGCTGGGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1527s21c1
Sequence:CCGGTGTCAGACATGGTCATGTATGCTCGAGCATACATGACCATGTCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1501s21c1
Sequence:CCGGGATGACGGACTCCTCTCATATCTCGAGATATGAGAGGAGTCCGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1361s21c1
Sequence:CCGGGTCGCCATCGACAACACAAACCTCGAGGTTTGTGTTGTCGATGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-378s21c1
Sequence:CCGGACACACTGTATTTGGTCAATGCTCGAGCATTGACCAAATACAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007254.2-295s21c1
Sequence:CCGGAGTGAAACAGCTGGGAGTTAACTCGAGTTAACTCCCAGCTGTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007254
VALIDATED
PNKP MISSION shRNA Lentiviral Transduction Particles
polynucleotide kinase 3'-phosphatase
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-377s1c1
Sequence:CCGGGACACACTGTATTTGGTCAATCTCGAGATTGACCAAATACAGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_007254.2-553s1c1
Sequence:CCGGCTTGGAGAAGTTGCTAGTGTTCTCGAGAACACTAGCAACTTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-517s1c1
Sequence:CCGGGAAGCGTATGCGGAAGTCAAACTCGAGTTTGACTTCCGCATACGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007254.2-1543s1c1
Sequence:CCGGGTATGGCTACAGGAAGCAGTTCTCGAGAACTGCTTCCTGTAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007254.2-1526s1c1
Sequence:CCGGGTGTCAGACATGGTCATGTATCTCGAGATACATGACCATGTCTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-734s21c1
Sequence:CCGGGGCTACAAGCTGGTGATCTTCCTCGAGGAAGATCACCAGCTTGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-236s21c1
Sequence:CCGGCGGAAGTGCTCCAGAACTCAACTCGAGTTGAGTTCTGGAGCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1272s21c1
Sequence:CCGGCCGGATATGTCCACGTGAACACTCGAGTGTTCACGTGGACATATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-672s21c1
Sequence:CCGGCCAGTGACTGGAGGATCTTGTCTCGAGACAAGATCCTCCAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-642s21c1
Sequence:CCGGCACGCTCTGGGAAGGTCTTTCCTCGAGGAAAGACCTTCCCAGAGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1112s21c1
Sequence:CCGGTTCGAGCTCCCAGCCTTTGATCTCGAGATCAAAGGCTGGGAGCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-441s21c1
Sequence:CCGGCAGAATCCCAGCCAGATACTCCTCGAGGAGTATCTGGCTGGGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1527s21c1
Sequence:CCGGTGTCAGACATGGTCATGTATGCTCGAGCATACATGACCATGTCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1501s21c1
Sequence:CCGGGATGACGGACTCCTCTCATATCTCGAGATATGAGAGGAGTCCGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-1361s21c1
Sequence:CCGGGTCGCCATCGACAACACAAACCTCGAGGTTTGTGTTGTCGATGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007254.2-378s21c1
Sequence:CCGGACACACTGTATTTGGTCAATGCTCGAGCATTGACCAAATACAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007254.2-295s21c1
Sequence:CCGGAGTGAAACAGCTGGGAGTTAACTCGAGTTAACTCCCAGCTGTTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)