EMAIL THIS PAGE TO A FRIEND

PNLIP

pancreatic lipase

65 Gene Product Result for
Synonyms: PL PNLIPD PTL
UniProtKB ID: P16233, Q5VSQ2
Gene ID:
Human(5406) Summary: This gene is a member of the lipase gene family. It encodes a carboxyl esterase that hydrolyzes insoluble, emulsified triglycerides, and is essential for the efficient digestion of dietary fats. This gene is expressed specifically in the pancreas. [provided by RefSeq, Jul 2008]
Mouse(69060) pancreatic lipase
Rat(25702) pancreatic lipase
cow(515764) pancreatic lipase
sheep(101103610) pancreatic lipase
Domestic Rabbit(100009157) pancreatic lipase
domestic guinea pig(100135601) pancreatic lipase
chicken(423916) pancreatic lipase
Horse(100034202) pancreatic lipase
dog(477830) pancreatic lipase
domestic cat(101083211) pancreatic lipase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O4139 Orlistat ≥98%, solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000936 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000936 Rosetta Predictions human pricing
NM_013161 Rosetta Predictions rat pricing
NM_026925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138985 predicted 241
2 SASI_Hs01_00138986 predicted 671
3 SASI_Hs01_00138987 predicted 1137
4 SASI_Hs01_00138988 predicted 1150
5 SASI_Hs01_00138989 predicted 961
6 SASI_Hs01_00138990 predicted 1234
7 SASI_Hs01_00138991 predicted 512
8 SASI_Hs01_00138992 predicted 1218
9 SASI_Hs02_00303537 predicted 355
10 SASI_Hs02_00303538 predicted 253
11 SASI_Hs01_00138984 predicted 1043
12 SASI_Hs01_00138993 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037298 predicted 1007
2 SASI_Rn01_00037299 predicted 506
3 SASI_Rn01_00037300 predicted 1221
4 SASI_Rn01_00037301 predicted 1222
5 SASI_Rn01_00037302 predicted 464
6 SASI_Rn01_00037303 predicted 1248
7 SASI_Rn01_00037304 predicted 1241
8 SASI_Rn01_00037305 predicted 743
9 SASI_Rn01_00037306 predicted 880
10 SASI_Rn01_00037307 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045572 predicted 208
2 SASI_Mm01_00045573 predicted 1214
3 SASI_Mm02_00331217 predicted 744
4 SASI_Mm01_00045574 predicted 334
5 SASI_Mm01_00045576 predicted 208
6 SASI_Mm01_00045577 predicted 460
7 SASI_Mm01_00045579 predicted 484
8 SASI_Mm01_00045580 predicted 1232
9 SASI_Mm02_00331218 predicted 215
10 SASI_Mm02_00331219 predicted 844
11 SASI_Mm01_00045575 predicted 957
12 SASI_Mm01_00045578 predicted 1240
13 SASI_Mm01_00045581 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000936
PNLIP MISSION shRNA Bacterial Glycerol Stock
pancreatic lipase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-199s1c1
Sequence:CCGGCCAAACAACTTTCAAGAAGTTCTCGAGAACTTCTTGAAAGTTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-490s1c1
Sequence:CCGGCCTTCCAACGTGCATGTCATTCTCGAGAATGACATGCACGTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-1313s1c1
Sequence:CCGGCCAAGATTATAGTGGAGACAACTCGAGTTGTCTCCACTATAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-994s1c1
Sequence:CCGGGCTGATAGATATCCTGGGAAACTCGAGTTTCCCAGGATATCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-614s1c1
Sequence:CCGGGCACACCTGAATTAGTCCGATCTCGAGATCGGACTAATTCAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-867s21c1
Sequence:CCGGTTGCGGCCTGTAATCACTTAACTCGAGTTAAGTGATTACAGGCCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-751s21c1
Sequence:CCGGAGTCGTGGGCCACCTAGATTTCTCGAGAAATCTAGGTGGCCCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-199s21c1
Sequence:CCGGCACCCGCTTCCTCCTATATACCTCGAGGTATATAGGAGGAAGCGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000936
PNLIP MISSION shRNA shRNA Plasmid DNA
pancreatic lipase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-199s1c1
Sequence:CCGGCCAAACAACTTTCAAGAAGTTCTCGAGAACTTCTTGAAAGTTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-490s1c1
Sequence:CCGGCCTTCCAACGTGCATGTCATTCTCGAGAATGACATGCACGTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-1313s1c1
Sequence:CCGGCCAAGATTATAGTGGAGACAACTCGAGTTGTCTCCACTATAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-994s1c1
Sequence:CCGGGCTGATAGATATCCTGGGAAACTCGAGTTTCCCAGGATATCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-614s1c1
Sequence:CCGGGCACACCTGAATTAGTCCGATCTCGAGATCGGACTAATTCAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-867s21c1
Sequence:CCGGTTGCGGCCTGTAATCACTTAACTCGAGTTAAGTGATTACAGGCCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-751s21c1
Sequence:CCGGAGTCGTGGGCCACCTAGATTTCTCGAGAAATCTAGGTGGCCCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-199s21c1
Sequence:CCGGCACCCGCTTCCTCCTATATACCTCGAGGTATATAGGAGGAAGCGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000936
PNLIP MISSION shRNA Lentiviral Transduction Particles
pancreatic lipase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-199s1c1
Sequence:CCGGCCAAACAACTTTCAAGAAGTTCTCGAGAACTTCTTGAAAGTTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-490s1c1
Sequence:CCGGCCTTCCAACGTGCATGTCATTCTCGAGAATGACATGCACGTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-1313s1c1
Sequence:CCGGCCAAGATTATAGTGGAGACAACTCGAGTTGTCTCCACTATAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-994s1c1
Sequence:CCGGGCTGATAGATATCCTGGGAAACTCGAGTTTCCCAGGATATCTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000936.1-614s1c1
Sequence:CCGGGCACACCTGAATTAGTCCGATCTCGAGATCGGACTAATTCAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-867s21c1
Sequence:CCGGTTGCGGCCTGTAATCACTTAACTCGAGTTAAGTGATTACAGGCCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-751s21c1
Sequence:CCGGAGTCGTGGGCCACCTAGATTTCTCGAGAAATCTAGGTGGCCCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000936.2-199s21c1
Sequence:CCGGCACCCGCTTCCTCCTATATACCTCGAGGTATATAGGAGGAAGCGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026925
PNLIP MISSION shRNA Bacterial Glycerol Stock
pancreatic lipase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-954s1c1
Sequence:CCGGCGGCAAATAAGTGCTTCCCATCTCGAGATGGGAAGCACTTATTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-506s1c1
Sequence:CCGGCTTAACAATGTCCACCTGATTCTCGAGAATCAGGTGGACATTGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-402s21c1
Sequence:CCGGGCGGTTCCCGAACGACATATACTCGAGTATATGTCGTTCGGGAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-665s1c2
Sequence:CCGGGCTCAGTTTGTGGACGCAATTCTCGAGAATTGCGTCCACAAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-173s1c2
Sequence:CCGGGCACAGATCAACACCCGCTTTCTCGAGAAAGCGGGTGTTGATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-1211s1c2
Sequence:CCGGCCAGGTACTTCTCACGTCAATCTCGAGATTGACGTGAGAAGTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-1257s21c1
Sequence:CCGGGAGATTTGCAGAAGGTTAAATCTCGAGATTTAACCTTCTGCAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026925
PNLIP MISSION shRNA shRNA Plasmid DNA
pancreatic lipase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-954s1c1
Sequence:CCGGCGGCAAATAAGTGCTTCCCATCTCGAGATGGGAAGCACTTATTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-506s1c1
Sequence:CCGGCTTAACAATGTCCACCTGATTCTCGAGAATCAGGTGGACATTGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-402s21c1
Sequence:CCGGGCGGTTCCCGAACGACATATACTCGAGTATATGTCGTTCGGGAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-665s1c2
Sequence:CCGGGCTCAGTTTGTGGACGCAATTCTCGAGAATTGCGTCCACAAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-173s1c2
Sequence:CCGGGCACAGATCAACACCCGCTTTCTCGAGAAAGCGGGTGTTGATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-1211s1c2
Sequence:CCGGCCAGGTACTTCTCACGTCAATCTCGAGATTGACGTGAGAAGTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-1257s21c1
Sequence:CCGGGAGATTTGCAGAAGGTTAAATCTCGAGATTTAACCTTCTGCAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026925
PNLIP MISSION shRNA Lentiviral Transduction Particles
pancreatic lipase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-954s1c1
Sequence:CCGGCGGCAAATAAGTGCTTCCCATCTCGAGATGGGAAGCACTTATTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-506s1c1
Sequence:CCGGCTTAACAATGTCCACCTGATTCTCGAGAATCAGGTGGACATTGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-402s21c1
Sequence:CCGGGCGGTTCCCGAACGACATATACTCGAGTATATGTCGTTCGGGAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-665s1c2
Sequence:CCGGGCTCAGTTTGTGGACGCAATTCTCGAGAATTGCGTCCACAAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-173s1c2
Sequence:CCGGGCACAGATCAACACCCGCTTTCTCGAGAAAGCGGGTGTTGATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026925.3-1211s1c2
Sequence:CCGGCCAGGTACTTCTCACGTCAATCTCGAGATTGACGTGAGAAGTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026925.3-1257s21c1
Sequence:CCGGGAGATTTGCAGAAGGTTAAATCTCGAGATTTAACCTTCTGCAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)