EMAIL THIS PAGE TO A FRIEND

PNLIPRP3

pancreatic lipase-related protein 3

71 Gene Product Result for
UniProtKB ID: Q17RR3
Gene ID:
chicken(771362) pancreatic triacylglycerol lipase-like
Horse(100067785) pancreatic lipase-related protein 3
domestic cat(101085498) pancreatic lipase-related protein 3
dog(610501) pancreatic lipase-related protein 3
chicken(771374) pancreatic lipase-related protein 3
cow(531271) pancreatic lipase-related protein 3
sheep(101103362) pancreatic lipase-related protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011709 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011709 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237046 predicted 1511
2 SASI_Hs01_00237047 predicted 780
3 SASI_Hs01_00237048 predicted 840
4 SASI_Hs01_00237049 predicted 978
5 SASI_Hs01_00237050 predicted 1558
6 SASI_Hs01_00237051 predicted 1627
7 SASI_Hs01_00237052 predicted 836
8 SASI_Hs01_00237053 predicted 1245
9 SASI_Hs01_00237055 predicted 1458
10 SASI_Hs02_00306031 predicted 1209
11 SASI_Hs01_00237054 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011709
PNLIPRP3 MISSION shRNA Bacterial Glycerol Stock
pancreatic lipase-related protein 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000448132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011709.2-732s21c1
Sequence:CCGGGCCAACTTTGTTGACGTTATTCTCGAGAATAACGTCAACAAAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011709.1-2138s1c1
Sequence:CCGGGCTTATCTGTTATGTGTTCATCTCGAGATGAACACATAACAGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-377s1c1
Sequence:CCGGCAACTATCCAAGCCTCATATTCTCGAGAATATGAGGCTTGGATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-547s1c1
Sequence:CCGGGCTGTAAACAATCTCCGTGTTCTCGAGAACACGGAGATTGTTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-1435s1c1
Sequence:CCGGCAGAATAAGTTGGGAGCAGAACTCGAGTTCTGCTCCCAACTTATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-984s1c1
Sequence:CCGGCCATGCCCGAAGTTATCAATTCTCGAGAATTGATAACTTCGGGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011709
PNLIPRP3 MISSION shRNA shRNA Plasmid DNA
pancreatic lipase-related protein 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000448132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011709.2-732s21c1
Sequence:CCGGGCCAACTTTGTTGACGTTATTCTCGAGAATAACGTCAACAAAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011709.1-2138s1c1
Sequence:CCGGGCTTATCTGTTATGTGTTCATCTCGAGATGAACACATAACAGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-377s1c1
Sequence:CCGGCAACTATCCAAGCCTCATATTCTCGAGAATATGAGGCTTGGATAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-547s1c1
Sequence:CCGGGCTGTAAACAATCTCCGTGTTCTCGAGAACACGGAGATTGTTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-1435s1c1
Sequence:CCGGCAGAATAAGTTGGGAGCAGAACTCGAGTTCTGCTCCCAACTTATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-984s1c1
Sequence:CCGGCCATGCCCGAAGTTATCAATTCTCGAGAATTGATAACTTCGGGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011709
PNLIPRP3 MISSION shRNA Lentiviral Transduction Particles
pancreatic lipase-related protein 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000448132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011709.2-732s21c1
Sequence:CCGGGCCAACTTTGTTGACGTTATTCTCGAGAATAACGTCAACAAAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011709.1-2138s1c1
Sequence:CCGGGCTTATCTGTTATGTGTTCATCTCGAGATGAACACATAACAGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-377s1c1
Sequence:CCGGCAACTATCCAAGCCTCATATTCTCGAGAATATGAGGCTTGGATAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-547s1c1
Sequence:CCGGGCTGTAAACAATCTCCGTGTTCTCGAGAACACGGAGATTGTTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-1435s1c1
Sequence:CCGGCAGAATAAGTTGGGAGCAGAACTCGAGTTCTGCTCCCAACTTATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011709.1-984s1c1
Sequence:CCGGCCATGCCCGAAGTTATCAATTCTCGAGAATTGATAACTTCGGGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)