EMAIL THIS PAGE TO A FRIEND

PNMA1

paraneoplastic Ma antigen 1

91 Gene Product Result for
Synonyms: MA1
UniProtKB ID: Q8ND90, A8K4L5, O95144, Q8NG07
Gene ID:
Human(9240) Summary: The PNMA1 gene encodes an antineuronal antibody (anti-Ma) present in patients with paraneoplastic neurologic disorders (Dalmau et al., 1999 [PubMed 10050892]
Mouse(70481) paraneoplastic antigen MA1
Rat(170636) paraneoplastic Ma antigen 1
cow(538718) paraneoplastic antigen MA1
sheep(101104752) paraneoplastic Ma antigen 1
domestic guinea pig(100730748) paraneoplastic Ma antigen 1
naked mole-rat(101711953) paraneoplastic Ma antigen 1
dog(490774) paraneoplastic Ma antigen 1
Horse(100050444) paraneoplastic Ma antigen 1
domestic cat(101088498) paraneoplastic Ma antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002131 MISSION® esiRNA esiRNA targeting human PNMA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006029 Rosetta Predictions human pricing
NM_130820 Rosetta Predictions rat pricing
NM_027438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149948 predicted 1505
2 SASI_Hs01_00149949 predicted 1451
3 SASI_Hs01_00149950 predicted 1238
4 SASI_Hs01_00149951 predicted 1123
5 SASI_Hs01_00149952 predicted 1185
6 SASI_Hs01_00149953 predicted 1069
7 SASI_Hs01_00149954 predicted 863
8 SASI_Hs01_00149955 predicted 1465
9 SASI_Hs01_00149956 predicted 983
10 SASI_Hs01_00149957 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090354 predicted 868
2 SASI_Rn01_00090355 predicted 1246
3 SASI_Rn02_00267513 predicted 981
4 SASI_Rn01_00090356 predicted 845
5 SASI_Rn01_00090357 predicted 977
6 SASI_Rn01_00090358 predicted 1068
7 SASI_Rn01_00090359 predicted 1169
8 SASI_Rn01_00090360 predicted 1235
9 SASI_Rn01_00090361 predicted 1155
10 SASI_Rn01_00090362 predicted 591
11 SASI_Rn01_00090363 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164825 predicted 1010
2 SASI_Mm01_00164826 predicted 1024
3 SASI_Mm01_00164827 predicted 1296
4 SASI_Mm01_00164828 predicted 640
5 SASI_Mm02_00332192 predicted 1893
6 SASI_Mm01_00164829 predicted 1737
7 SASI_Mm01_00164830 predicted 1340
8 SASI_Mm01_00164831 predicted 1222
9 SASI_Mm01_00164832 predicted 1518
10 SASI_Mm01_00164833 predicted 1239
11 SASI_Mm01_00164834 predicted 1692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006029
VALIDATED
PNMA1 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1195s1c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1417s1c1
Sequence:CCGGGCTGATGTTATTCGCATCCTTCTCGAGAAGGATGCGAATAACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1330s21c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006029.4-2114s1c1
Sequence:CCGGGCTGTCATCATGGACATCATACTCGAGTATGATGTCCATGATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-868s1c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006029.4-868s21c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1919s21c1
Sequence:CCGGGATGTGTCTCTGAGTAGTAAACTCGAGTTTACTACTCAGAGACACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-1330s1c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1514s21c1
Sequence:CCGGCTAGGGATGCCCAGATCAAATCTCGAGATTTGATCTGGGCATCCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1195s21c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006029
VALIDATED
PNMA1 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1195s1c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1417s1c1
Sequence:CCGGGCTGATGTTATTCGCATCCTTCTCGAGAAGGATGCGAATAACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1330s21c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006029.4-2114s1c1
Sequence:CCGGGCTGTCATCATGGACATCATACTCGAGTATGATGTCCATGATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-868s1c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006029.4-868s21c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1919s21c1
Sequence:CCGGGATGTGTCTCTGAGTAGTAAACTCGAGTTTACTACTCAGAGACACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-1330s1c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1514s21c1
Sequence:CCGGCTAGGGATGCCCAGATCAAATCTCGAGATTTGATCTGGGCATCCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1195s21c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006029
VALIDATED
PNMA1 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1195s1c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006029.4-1417s1c1
Sequence:CCGGGCTGATGTTATTCGCATCCTTCTCGAGAAGGATGCGAATAACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1330s21c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006029.4-2114s1c1
Sequence:CCGGGCTGTCATCATGGACATCATACTCGAGTATGATGTCCATGATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-868s1c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006029.4-868s21c1
Sequence:CCGGGTGAACTGTGATGAGGCTGAACTCGAGTTCAGCCTCATCACAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1919s21c1
Sequence:CCGGGATGTGTCTCTGAGTAGTAAACTCGAGTTTACTACTCAGAGACACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006029.4-1330s1c1
Sequence:CCGGGAGCACACTAATGAGGTCCTACTCGAGTAGGACCTCATTAGTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1514s21c1
Sequence:CCGGCTAGGGATGCCCAGATCAAATCTCGAGATTTGATCTGGGCATCCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006029.4-1195s21c1
Sequence:CCGGCCAGCAGAGATGCTAAACTATCTCGAGATAGTTTAGCATCTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027438
PNMA1 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-1463s1c1
Sequence:CCGGCTTCCAGTTACTGGTGCAGATCTCGAGATCTGCACCAGTAACTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-969s1c1
Sequence:CCGGTGGTATAAGAAGCTGACGTTACTCGAGTAACGTCAGCTTCTTATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027438.1-1689s1c1
Sequence:CCGGGCCCGCATATTCCTGTAACATCTCGAGATGTTACAGGAATATGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-711s1c1
Sequence:CCGGGCAGTGGATTACTCCCTGATACTCGAGTATCAGGGAGTAATCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-912s1c1
Sequence:CCGGGCAGAGATGCTCAACTATATTCTCGAGAATATAGTTGAGCATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027438
PNMA1 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-1463s1c1
Sequence:CCGGCTTCCAGTTACTGGTGCAGATCTCGAGATCTGCACCAGTAACTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-969s1c1
Sequence:CCGGTGGTATAAGAAGCTGACGTTACTCGAGTAACGTCAGCTTCTTATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027438.1-1689s1c1
Sequence:CCGGGCCCGCATATTCCTGTAACATCTCGAGATGTTACAGGAATATGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-711s1c1
Sequence:CCGGGCAGTGGATTACTCCCTGATACTCGAGTATCAGGGAGTAATCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-912s1c1
Sequence:CCGGGCAGAGATGCTCAACTATATTCTCGAGAATATAGTTGAGCATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027438
PNMA1 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-1463s1c1
Sequence:CCGGCTTCCAGTTACTGGTGCAGATCTCGAGATCTGCACCAGTAACTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-969s1c1
Sequence:CCGGTGGTATAAGAAGCTGACGTTACTCGAGTAACGTCAGCTTCTTATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027438.1-1689s1c1
Sequence:CCGGGCCCGCATATTCCTGTAACATCTCGAGATGTTACAGGAATATGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-711s1c1
Sequence:CCGGGCAGTGGATTACTCCCTGATACTCGAGTATCAGGGAGTAATCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027438.1-912s1c1
Sequence:CCGGGCAGAGATGCTCAACTATATTCTCGAGAATATAGTTGAGCATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)