EMAIL THIS PAGE TO A FRIEND

PNMA3

paraneoplastic Ma antigen 3

60 Gene Product Result for
Synonyms: MA3 MA5
UniProtKB ID: Q9UL41, D3DWT7, Q9H0A4
Gene ID:
Human(29944) Summary: This gene is a member of the paraneoplastic antigen MA (PNMA) gene family, whose protein products share homology with retroviral Gag proteins. They are highly expressed in the brain and also in a range of tumors associated with serious neurological phenotypes. PMID:16407312 reports the presence of a functional -1 ribosomal frameshift signal (consisting of a heptanucleotide shift motif followed 3' by a pseudoknot structure) in this gene, however, the frame-shifted product has not been characterized. [provided by RefSeq, Jul 2008]
Mouse(245468) paraneoplastic antigen MA3
Rat(293840) paraneoplastic Ma antigen 3
Horse(100056995) paraneoplastic Ma antigen 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013364 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010901 MISSION® esiRNA esiRNA targeting human PNMA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013364 Rosetta Predictions human pricing
NM_001106342 Rosetta Predictions rat pricing
NM_153169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035255 predicted 1238
2 SASI_Hs01_00035257 predicted 1151
3 SASI_Hs01_00035258 predicted 1127
4 SASI_Hs01_00035259 predicted 647
5 SASI_Hs01_00035260 predicted 1180
6 SASI_Hs01_00035261 predicted 1251
7 SASI_Hs01_00035262 predicted 868
8 SASI_Hs01_00035263 predicted 736
9 SASI_Hs01_00035264 predicted 555
10 SASI_Hs02_00344699 predicted 1194
11 SASI_Hs01_00035256 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218028 predicted 346
2 SASI_Rn02_00218029 predicted 1420
3 SASI_Rn02_00218030 predicted 539
4 SASI_Rn02_00218031 predicted 1481
5 SASI_Rn02_00218032 predicted 411
6 SASI_Rn02_00218033 predicted 682
7 SASI_Rn02_00218034 predicted 1264
8 SASI_Rn02_00218035 predicted 978
9 SASI_Rn02_00218036 predicted 690
10 SASI_Rn02_00218037 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035625 predicted 544
2 SASI_Mm01_00035626 predicted 1234
3 SASI_Mm01_00035627 predicted 1299
4 SASI_Mm01_00035628 predicted 345
5 SASI_Mm01_00035629 predicted 1087
6 SASI_Mm01_00035630 predicted 1428
7 SASI_Mm01_00035631 predicted 320
8 SASI_Mm01_00035632 predicted 1275
9 SASI_Mm01_00035633 predicted 698
10 SASI_Mm01_00035634 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153169
PNMA3 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153169.1-1697s1c1
Sequence:CCGGCCTCTAAGATTCACCAGAGAACTCGAGTTCTCTGGTGAATCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-585s1c1
Sequence:CCGGCCATATCAATCCCAGGGTTATCTCGAGATAACCCTGGGATTGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1344s1c1
Sequence:CCGGGCCATATCAGAGTACACTGTTCTCGAGAACAGTGTACTCTGATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-707s1c1
Sequence:CCGGCCTGCTCTACAGGTTGTCAATCTCGAGATTGACAACCTGTAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1169s1c1
Sequence:CCGGGAACTATTTGTTCCGGCCTTTCTCGAGAAAGGCCGGAACAAATAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153169
PNMA3 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153169.1-1697s1c1
Sequence:CCGGCCTCTAAGATTCACCAGAGAACTCGAGTTCTCTGGTGAATCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-585s1c1
Sequence:CCGGCCATATCAATCCCAGGGTTATCTCGAGATAACCCTGGGATTGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1344s1c1
Sequence:CCGGGCCATATCAGAGTACACTGTTCTCGAGAACAGTGTACTCTGATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-707s1c1
Sequence:CCGGCCTGCTCTACAGGTTGTCAATCTCGAGATTGACAACCTGTAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1169s1c1
Sequence:CCGGGAACTATTTGTTCCGGCCTTTCTCGAGAAAGGCCGGAACAAATAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153169
PNMA3 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153169.1-1697s1c1
Sequence:CCGGCCTCTAAGATTCACCAGAGAACTCGAGTTCTCTGGTGAATCTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-585s1c1
Sequence:CCGGCCATATCAATCCCAGGGTTATCTCGAGATAACCCTGGGATTGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1344s1c1
Sequence:CCGGGCCATATCAGAGTACACTGTTCTCGAGAACAGTGTACTCTGATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-707s1c1
Sequence:CCGGCCTGCTCTACAGGTTGTCAATCTCGAGATTGACAACCTGTAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153169.1-1169s1c1
Sequence:CCGGGAACTATTTGTTCCGGCCTTTCTCGAGAAAGGCCGGAACAAATAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013364
PNMA3 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1211s21c1
Sequence:CCGGCTCGCCTGAAACGAGTCTTAACTCGAGTTAAGACTCGTTTCAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1187s21c1
Sequence:GTACCGGTATCACGTAGAAACGTGAATCCTCGAGGATTCACGTTTCTACGTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013364.1-496s1c1
Sequence:CCGGGAACAAATGTTGTACCGAGAACTCGAGTTCTCGGTACAACATTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013364.4-1732s21c1
Sequence:CCGGCGGGAGAACAGGGCAACATTTCTCGAGAAATGTTGCCCTGTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-729s21c1
Sequence:CCGGGGCTCCAAGAGTGACTATATCCTCGAGGATATAGTCACTCTTGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1245s21c1
Sequence:CCGGTCCTGACAAACTCCGAGATAACTCGAGTTATCTCGGAGTTTGTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013364
PNMA3 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1211s21c1
Sequence:CCGGCTCGCCTGAAACGAGTCTTAACTCGAGTTAAGACTCGTTTCAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1187s21c1
Sequence:GTACCGGTATCACGTAGAAACGTGAATCCTCGAGGATTCACGTTTCTACGTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013364.1-496s1c1
Sequence:CCGGGAACAAATGTTGTACCGAGAACTCGAGTTCTCGGTACAACATTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013364.4-1732s21c1
Sequence:CCGGCGGGAGAACAGGGCAACATTTCTCGAGAAATGTTGCCCTGTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-729s21c1
Sequence:CCGGGGCTCCAAGAGTGACTATATCCTCGAGGATATAGTCACTCTTGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1245s21c1
Sequence:CCGGTCCTGACAAACTCCGAGATAACTCGAGTTATCTCGGAGTTTGTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013364
PNMA3 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1211s21c1
Sequence:CCGGCTCGCCTGAAACGAGTCTTAACTCGAGTTAAGACTCGTTTCAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1187s21c1
Sequence:GTACCGGTATCACGTAGAAACGTGAATCCTCGAGGATTCACGTTTCTACGTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013364.1-496s1c1
Sequence:CCGGGAACAAATGTTGTACCGAGAACTCGAGTTCTCGGTACAACATTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013364.4-1732s21c1
Sequence:CCGGCGGGAGAACAGGGCAACATTTCTCGAGAAATGTTGCCCTGTTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-729s21c1
Sequence:CCGGGGCTCCAAGAGTGACTATATCCTCGAGGATATAGTCACTCTTGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013364.4-1245s21c1
Sequence:CCGGTCCTGACAAACTCCGAGATAACTCGAGTTATCTCGGAGTTTGTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)