EMAIL THIS PAGE TO A FRIEND

PNMA5

paraneoplastic Ma antigen family member 5

81 Gene Product Result for
UniProtKB ID: Q96PV4, B4DI72, Q495L5, Q8NET3
Gene ID:
Human(114824) Summary: This gene encodes a member of the paraneoplastic Ma antigen protein family. These proteins have been implicated in the development of paraneoplastic disorders resulting from an immune response directed against them. Paraneoplastic disorders are the result of an abnormal immune response to a tumor. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2011]
Mouse(385377) paraneoplastic antigen family 5
Rat(309266) paraneoplastic Ma antigen family member 5
domestic guinea pig(100727719) paraneoplastic Ma antigen family member 5
cow(785413) paraneoplastic Ma antigen family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_359410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103150 Rosetta Predictions human pricing
NM_001103151 Rosetta Predictions human pricing
NM_052926 Rosetta Predictions human pricing
NM_001107579 Rosetta Predictions rat pricing
NM_001100461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323573 predicted 1284
2 SASI_Hs02_00323574 predicted 1164
3 SASI_Hs02_00323575 predicted 1786
4 SASI_Hs02_00323576 predicted 1203
5 SASI_Hs02_00323577 predicted 878
6 SASI_Hs02_00323578 predicted 1617
7 SASI_Hs02_00323579 predicted 1152
8 SASI_Hs02_00323580 predicted 749
9 SASI_Hs02_00323581 predicted 1847
10 SASI_Hs02_00323582 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323583 predicted 1192
2 SASI_Hs02_00323584 predicted 1065
3 SASI_Hs02_00323585 predicted 1687
4 SASI_Hs02_00323586 predicted 1105
5 SASI_Hs02_00323587 predicted 782
6 SASI_Hs02_00323588 predicted 1516
7 SASI_Hs02_00323589 predicted 1053
8 SASI_Hs02_00323590 predicted 652
9 SASI_Hs02_00323591 predicted 1746
10 SASI_Hs02_00323592 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038473 predicted 1277
2 SASI_Hs01_00038474 predicted 1147
3 SASI_Hs01_00038475 predicted 1766
4 SASI_Hs01_00038476 predicted 1190
5 SASI_Hs01_00038477 predicted 869
6 SASI_Hs01_00038478 predicted 1599
7 SASI_Hs01_00038479 predicted 1138
8 SASI_Hs01_00038480 predicted 733
9 SASI_Hs01_00038481 predicted 1831
10 SASI_Hs02_00361686 predicted 856
11 SASI_Hs01_00038482 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230225 predicted 522
2 SASI_Rn02_00230226 predicted 1226
3 SASI_Rn02_00230227 predicted 1147
4 SASI_Rn02_00230228 predicted 770
5 SASI_Rn02_00230229 predicted 402
6 SASI_Rn02_00230230 predicted 448
7 SASI_Rn02_00230231 predicted 297
8 SASI_Rn02_00230232 predicted 1189
9 SASI_Rn02_00230233 predicted 309
10 SASI_Rn02_00230234 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302236 predicted 548
2 SASI_Mm02_00302237 predicted 706
3 SASI_Mm02_00302238 predicted 203
4 SASI_Mm02_00302239 predicted 339
5 SASI_Mm02_00302240 predicted 320
6 SASI_Mm02_00302241 predicted 1664
7 SASI_Mm02_00302242 predicted 1077
8 SASI_Mm02_00302243 predicted 428
9 SASI_Mm02_00302244 predicted 1620
10 SASI_Mm02_00302245 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052926
PNMA5 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1171s21c1
Sequence:CCGGTGCAGACCTCTCCGAAGATTGCTCGAGCAATCTTCGGAGAGGTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-511s21c1
Sequence:CCGGAGTGTAGTGAGGTGGAAATTCCTCGAGGAATTTCCACCTCACTACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1073s21c1
Sequence:CCGGGGCCAACAATGACTCCATAACCTCGAGGTTATGGAGTCATTGTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-1280s1c1
Sequence:CCGGGATTCGTCTGAAACATCTCTTCTCGAGAAGAGATGTTTCAGACGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-871s1c1
Sequence:CCGGCGAAAGAAAGTATGTGGTACACTCGAGTGTACCACATACTTTCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-738s1c1
Sequence:CCGGCTGAACTACTTCCTGAAAGATCTCGAGATCTTTCAGGAAGTAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052926.1-2288s1c1
Sequence:CCGGGCCTGTCTTTAGGATCATCTACTCGAGTAGATGATCCTAAAGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-966s1c1
Sequence:CCGGGTCACTGAGATAATGCCCATACTCGAGTATGGGCATTATCTCAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052926
PNMA5 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1171s21c1
Sequence:CCGGTGCAGACCTCTCCGAAGATTGCTCGAGCAATCTTCGGAGAGGTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-511s21c1
Sequence:CCGGAGTGTAGTGAGGTGGAAATTCCTCGAGGAATTTCCACCTCACTACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1073s21c1
Sequence:CCGGGGCCAACAATGACTCCATAACCTCGAGGTTATGGAGTCATTGTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-1280s1c1
Sequence:CCGGGATTCGTCTGAAACATCTCTTCTCGAGAAGAGATGTTTCAGACGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-871s1c1
Sequence:CCGGCGAAAGAAAGTATGTGGTACACTCGAGTGTACCACATACTTTCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-738s1c1
Sequence:CCGGCTGAACTACTTCCTGAAAGATCTCGAGATCTTTCAGGAAGTAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052926.1-2288s1c1
Sequence:CCGGGCCTGTCTTTAGGATCATCTACTCGAGTAGATGATCCTAAAGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-966s1c1
Sequence:CCGGGTCACTGAGATAATGCCCATACTCGAGTATGGGCATTATCTCAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052926
PNMA5 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1171s21c1
Sequence:CCGGTGCAGACCTCTCCGAAGATTGCTCGAGCAATCTTCGGAGAGGTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-511s21c1
Sequence:CCGGAGTGTAGTGAGGTGGAAATTCCTCGAGGAATTTCCACCTCACTACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052926.2-1073s21c1
Sequence:CCGGGGCCAACAATGACTCCATAACCTCGAGGTTATGGAGTCATTGTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-1280s1c1
Sequence:CCGGGATTCGTCTGAAACATCTCTTCTCGAGAAGAGATGTTTCAGACGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-871s1c1
Sequence:CCGGCGAAAGAAAGTATGTGGTACACTCGAGTGTACCACATACTTTCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-738s1c1
Sequence:CCGGCTGAACTACTTCCTGAAAGATCTCGAGATCTTTCAGGAAGTAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052926.1-2288s1c1
Sequence:CCGGGCCTGTCTTTAGGATCATCTACTCGAGTAGATGATCCTAAAGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052926.1-966s1c1
Sequence:CCGGGTCACTGAGATAATGCCCATACTCGAGTATGGGCATTATCTCAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359410
VALIDATED
PNMA5 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family member 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000112535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-100s1c1
Sequence:CCGGGCGATAAATGATGCTCTGAAACTCGAGTTTCAGAGCATCATTTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359410.1-193s1c1
Sequence:CCGGGTCTTAATTGAACTGCCTGAACTCGAGTTCAGGCAGTTCAATTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-1219s1c1
Sequence:CCGGCCCGATGAGCAGAAACCTTATCTCGAGATAAGGTTTCTGCTCATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-678s1c1
Sequence:CCGGGCAGTGCTTGAAAGCCCTAAACTCGAGTTTAGGGCTTTCAAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359410
VALIDATED
PNMA5 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family member 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000112535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-100s1c1
Sequence:CCGGGCGATAAATGATGCTCTGAAACTCGAGTTTCAGAGCATCATTTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359410.1-193s1c1
Sequence:CCGGGTCTTAATTGAACTGCCTGAACTCGAGTTCAGGCAGTTCAATTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-1219s1c1
Sequence:CCGGCCCGATGAGCAGAAACCTTATCTCGAGATAAGGTTTCTGCTCATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-678s1c1
Sequence:CCGGGCAGTGCTTGAAAGCCCTAAACTCGAGTTTAGGGCTTTCAAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359410
VALIDATED
PNMA5 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family member 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000112535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-100s1c1
Sequence:CCGGGCGATAAATGATGCTCTGAAACTCGAGTTTCAGAGCATCATTTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359410.1-193s1c1
Sequence:CCGGGTCTTAATTGAACTGCCTGAACTCGAGTTCAGGCAGTTCAATTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-1219s1c1
Sequence:CCGGCCCGATGAGCAGAAACCTTATCTCGAGATAAGGTTTCTGCTCATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_359410.1-678s1c1
Sequence:CCGGGCAGTGCTTGAAAGCCCTAAACTCGAGTTTAGGGCTTTCAAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)