EMAIL THIS PAGE TO A FRIEND

PNMAL1

paraneoplastic Ma antigen family-like 1

146 Gene Product Result for
UniProtKB ID: Q86V59, A8K2F3, Q5U638, Q8N3H4, Q9NVE8
Gene ID:
Mouse(71691) PNMA-like 1
Rat(361515) paraneoplastic Ma antigen family-like 1
dog(612194) PNMA-like protein 1-like
domestic cat(101091323) paraneoplastic Ma antigen family-like 1
cow(532062) PNMA-like 1
sheep(101121195) paraneoplastic Ma antigen family-like 1
domestic guinea pig(100725715) paraneoplastic Ma antigen family-like 1
naked mole-rat(101725894) paraneoplastic Ma antigen family-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018215 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071001 MISSION® esiRNA esiRNA human PNMAL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103149 Rosetta Predictions human pricing
NM_018215 Rosetta Predictions human pricing
NM_001108473 Rosetta Predictions rat pricing
NM_001007569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323563 predicted 969
2 SASI_Hs02_00323564 predicted 416
3 SASI_Hs02_00323565 predicted 771
4 SASI_Hs02_00323566 predicted 953
5 SASI_Hs02_00323567 predicted 1739
6 SASI_Hs02_00323568 predicted 1672
7 SASI_Hs02_00323569 predicted 524
8 SASI_Hs02_00323570 predicted 1776
9 SASI_Hs02_00323571 predicted 314
10 SASI_Hs02_00323572 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351516 predicted 969
2 SASI_Hs01_00084834 predicted 413
3 SASI_Hs02_00351517 predicted 764
4 SASI_Hs02_00351518 predicted 952
5 SASI_Hs02_00351519 predicted 1939
6 SASI_Hs02_00351520 predicted 1875
7 SASI_Hs01_00084838 predicted 528
8 SASI_Hs02_00351521 predicted 1984
9 SASI_Hs02_00351522 predicted 322
10 SASI_Hs02_00351523 predicted 565
11 SASI_Hs01_00084830 predicted 1630
12 SASI_Hs01_00084831 predicted 1603
13 SASI_Hs01_00084832 predicted 1282
14 SASI_Hs01_00084833 predicted 1444
15 SASI_Hs01_00084835 predicted 1627
16 SASI_Hs01_00084836 predicted 1646
17 SASI_Hs01_00084837 predicted 1560
18 SASI_Hs01_00084839 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238989 predicted 322
2 SASI_Rn02_00238990 predicted 1202
3 SASI_Rn02_00238991 predicted 1328
4 SASI_Rn02_00238992 predicted 1265
5 SASI_Rn02_00238993 predicted 1436
6 SASI_Rn02_00238994 predicted 1581
7 SASI_Rn02_00238995 predicted 1518
8 SASI_Rn02_00238996 predicted 656
9 SASI_Rn02_00238997 predicted 362
10 SASI_Rn02_00238998 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070948 predicted 296
2 SASI_Mm01_00070949 predicted 1095
3 SASI_Mm01_00070950 predicted 1277
4 SASI_Mm01_00070951 predicted 1306
5 SASI_Mm01_00070952 predicted 218
6 SASI_Mm01_00070953 predicted 202
7 SASI_Mm01_00070954 predicted 496
8 SASI_Mm01_00070955 predicted 500
9 SASI_Mm01_00070956 predicted 1199
10 SASI_Mm01_00070957 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007569
PNMAL1 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-911s21c1
Sequence:CCGGCAGCAATTACAATAAGGTTAACTCGAGTTAACCTTATTGTAATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-1386s21c1
Sequence:CCGGGATTCCAGGAAGCTATGATTTCTCGAGAAATCATAGCTTCCTGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-576s21c1
Sequence:CCGGGCAGTAGTACAGGTCATATTCCTCGAGGAATATGACCTGTACTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-206s21c1
Sequence:CCGGGTACTGTAGCCACGCAGAAATCTCGAGATTTCTGCGTGGCTACAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007569.1-1542s21c1
Sequence:CCGGCACACAGGCAATGGATGTAAGCTCGAGCTTACATCCATTGCCTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007569
PNMAL1 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-911s21c1
Sequence:CCGGCAGCAATTACAATAAGGTTAACTCGAGTTAACCTTATTGTAATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-1386s21c1
Sequence:CCGGGATTCCAGGAAGCTATGATTTCTCGAGAAATCATAGCTTCCTGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-576s21c1
Sequence:CCGGGCAGTAGTACAGGTCATATTCCTCGAGGAATATGACCTGTACTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-206s21c1
Sequence:CCGGGTACTGTAGCCACGCAGAAATCTCGAGATTTCTGCGTGGCTACAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007569.1-1542s21c1
Sequence:CCGGCACACAGGCAATGGATGTAAGCTCGAGCTTACATCCATTGCCTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007569
PNMAL1 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-911s21c1
Sequence:CCGGCAGCAATTACAATAAGGTTAACTCGAGTTAACCTTATTGTAATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-1386s21c1
Sequence:CCGGGATTCCAGGAAGCTATGATTTCTCGAGAAATCATAGCTTCCTGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-576s21c1
Sequence:CCGGGCAGTAGTACAGGTCATATTCCTCGAGGAATATGACCTGTACTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007569.1-206s21c1
Sequence:CCGGGTACTGTAGCCACGCAGAAATCTCGAGATTTCTGCGTGGCTACAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007569.1-1542s21c1
Sequence:CCGGCACACAGGCAATGGATGTAAGCTCGAGCTTACATCCATTGCCTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018215
VALIDATED
PNMAL1 MISSION shRNA Bacterial Glycerol Stock
paraneoplastic Ma antigen family-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1163s1c1
Sequence:CCGGGTTGGCTTTGAAGAAGCCCATCTCGAGATGGGCTTCTTCAAAGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-737s1c1
Sequence:CCGGGCAGATCATCTTCTGCATGGACTCGAGTCCATGCAGAAGATGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1052s1c1
Sequence:CCGGCAATTCCAACAGCACAGCTAACTCGAGTTAGCTGTGCTGTTGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-455s1c1
Sequence:CCGGGAATGTTAAAGCTGCCCTCATCTCGAGATGAGGGCAGCTTTAACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1386s1c1
Sequence:CCGGGTCTTGGTTGACTCAGAAGATCTCGAGATCTTCTGAGTCAACCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1397s1c1
Sequence:CCGGCTCAGAAGATGGCAGGAAGAACTCGAGTTCTTCCTGCCATCTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-939s1c1
Sequence:CCGGGAGCCTACCAAACCTTTGGTTCTCGAGAACCAAAGGTTTGGTAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-3081s1c1
Sequence:CCGGGCGAGGTTAGAAGTGGAAGAACTCGAGTTCTTCCACTTCTAACCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2846s1c1
Sequence:CCGGCCTGAGATAATGGTTTCCAAACTCGAGTTTGGAAACCATTATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2312s1c1
Sequence:CCGGCCCAGCTCTAATTCCATCCATCTCGAGATGGATGGAATTAGAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1283s1c1
Sequence:CCGGCCATGAAAGCCCACCAAAGAACTCGAGTTCTTTGGTGGGCTTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-983s1c1
Sequence:CCGGCTCCAGGAGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCTCCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018215
VALIDATED
PNMAL1 MISSION shRNA shRNA Plasmid DNA
paraneoplastic Ma antigen family-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1163s1c1
Sequence:CCGGGTTGGCTTTGAAGAAGCCCATCTCGAGATGGGCTTCTTCAAAGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-737s1c1
Sequence:CCGGGCAGATCATCTTCTGCATGGACTCGAGTCCATGCAGAAGATGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1052s1c1
Sequence:CCGGCAATTCCAACAGCACAGCTAACTCGAGTTAGCTGTGCTGTTGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-455s1c1
Sequence:CCGGGAATGTTAAAGCTGCCCTCATCTCGAGATGAGGGCAGCTTTAACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1386s1c1
Sequence:CCGGGTCTTGGTTGACTCAGAAGATCTCGAGATCTTCTGAGTCAACCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1397s1c1
Sequence:CCGGCTCAGAAGATGGCAGGAAGAACTCGAGTTCTTCCTGCCATCTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-939s1c1
Sequence:CCGGGAGCCTACCAAACCTTTGGTTCTCGAGAACCAAAGGTTTGGTAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-3081s1c1
Sequence:CCGGGCGAGGTTAGAAGTGGAAGAACTCGAGTTCTTCCACTTCTAACCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2846s1c1
Sequence:CCGGCCTGAGATAATGGTTTCCAAACTCGAGTTTGGAAACCATTATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2312s1c1
Sequence:CCGGCCCAGCTCTAATTCCATCCATCTCGAGATGGATGGAATTAGAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1283s1c1
Sequence:CCGGCCATGAAAGCCCACCAAAGAACTCGAGTTCTTTGGTGGGCTTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-983s1c1
Sequence:CCGGCTCCAGGAGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCTCCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018215
VALIDATED
PNMAL1 MISSION shRNA Lentiviral Transduction Particles
paraneoplastic Ma antigen family-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1163s1c1
Sequence:CCGGGTTGGCTTTGAAGAAGCCCATCTCGAGATGGGCTTCTTCAAAGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-737s1c1
Sequence:CCGGGCAGATCATCTTCTGCATGGACTCGAGTCCATGCAGAAGATGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1052s1c1
Sequence:CCGGCAATTCCAACAGCACAGCTAACTCGAGTTAGCTGTGCTGTTGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-455s1c1
Sequence:CCGGGAATGTTAAAGCTGCCCTCATCTCGAGATGAGGGCAGCTTTAACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-1386s1c1
Sequence:CCGGGTCTTGGTTGACTCAGAAGATCTCGAGATCTTCTGAGTCAACCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1397s1c1
Sequence:CCGGCTCAGAAGATGGCAGGAAGAACTCGAGTTCTTCCTGCCATCTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-939s1c1
Sequence:CCGGGAGCCTACCAAACCTTTGGTTCTCGAGAACCAAAGGTTTGGTAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-3081s1c1
Sequence:CCGGGCGAGGTTAGAAGTGGAAGAACTCGAGTTCTTCCACTTCTAACCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2846s1c1
Sequence:CCGGCCTGAGATAATGGTTTCCAAACTCGAGTTTGGAAACCATTATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018215.2-2312s1c1
Sequence:CCGGCCCAGCTCTAATTCCATCCATCTCGAGATGGATGGAATTAGAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-1283s1c1
Sequence:CCGGCCATGAAAGCCCACCAAAGAACTCGAGTTCTTTGGTGGGCTTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018215.2-983s1c1
Sequence:CCGGCTCCAGGAGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCTCCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)