EMAIL THIS PAGE TO A FRIEND

PNMT

phenylethanolamine N-methyltransferase

45 Gene Product Result for
Synonyms: PENT PNMTase
UniProtKB ID: P11086
Gene ID:
Human(5409) Summary: The product of this gene catalyzes the last step of the catecholamine biosynthesis pathway, which methylates norepinephrine to form epinephrine (adrenaline). The enzyme also has beta-carboline 2N-methyltransferase activity. This gene is thought to play a key step in regulating epinephrine production. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(18948) phenylethanolamine-N-methyltransferase
Rat(24661) phenylethanolamine-N-methyltransferase
chicken(776803) phenylethanolamine N-methyltransferase
domestic cat(101101350) phenylethanolamine N-methyltransferase
Horse(100033859) phenylethanolamine N-methyltransferase
dog(491023) phenylethanolamine N-methyltransferase
chicken(100858738) phenylethanolamine N-methyltransferase
cow(281413) phenylethanolamine N-methyltransferase
sheep(101103826) phenylethanolamine N-methyltransferase
domestic guinea pig(100727379) phenylethanolamine N-methyltransferase
naked mole-rat(101706187) phenylethanolamine N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A72405 2-Amino-1-phenylethanol 98% human pricing
T13005 1,2,3,4-Tetrahydroisoquinoline 95% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041871 MISSION® esiRNA targeting human PNMT human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002686 Rosetta Predictions human pricing
NM_031526 Rosetta Predictions rat pricing
NM_008890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021584 predicted 573
2 SASI_Hs01_00021585 predicted 501
3 SASI_Hs01_00021586 predicted 783
4 SASI_Hs01_00021587 predicted 442
5 SASI_Hs01_00021589 predicted 318
6 SASI_Hs01_00021590 predicted 467
7 SASI_Hs01_00021591 predicted 571
8 SASI_Hs01_00021592 predicted 516
9 SASI_Hs01_00021593 predicted 494
10 SASI_Hs02_00334249 predicted 516
11 SASI_Hs01_00021588 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264667 predicted 699
2 SASI_Rn02_00264668 predicted 384
3 SASI_Rn02_00264669 predicted 300
4 SASI_Rn02_00264670 predicted 373
5 SASI_Rn02_00264671 predicted 706
6 SASI_Rn02_00264672 predicted 476
7 SASI_Rn02_00264673 predicted 538
8 SASI_Rn02_00264674 predicted 318
9 SASI_Rn02_00264675 predicted 590
10 SASI_Rn02_00264676 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314899 predicted 290
2 SASI_Mm01_00033913 predicted 460
3 SASI_Mm01_00033914 predicted 309
4 SASI_Mm01_00033915 predicted 382
5 SASI_Mm02_00314900 predicted 435
6 SASI_Mm01_00033916 predicted 580
7 SASI_Mm01_00033917 predicted 596
8 SASI_Mm01_00033919 predicted 360
9 SASI_Mm01_00033920 predicted 329
10 SASI_Mm02_00314901 predicted 490
11 SASI_Mm01_00033918 predicted 392
12 SASI_Mm01_00033921 predicted 324
13 SASI_Mm01_00033922 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002686
PNMT MISSION shRNA Bacterial Glycerol Stock
phenylethanolamine N-methyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-787s21c1
Sequence:CCGGCCAGATCTTGCCAGCTTTCAGCTCGAGCTGAAAGCTGGCAAGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-505s1c1
Sequence:CCGGGAGGACATCACCATGACAGATCTCGAGATCTGTCATGGTGATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1000s1c1
Sequence:CCGGGCCCACCTTCAGACAGGCGTACTCGAGTACGCCTGTCTGAAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-440s1c1
Sequence:CCGGGCACCCTCATCGACATTGGTTCTCGAGAACCAATGTCGATGAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1020s1c1
Sequence:CCGGAGATGATGTCAAGGGCGTCTTCTCGAGAAGACGCCCTTGACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-948s1c1
Sequence:CCGGCCTGGTGCGTAGTGGCTACAACTCGAGTTGTAGCCACTACGCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-322s21c1
Sequence:CCGGGCCTACCTCCGCAACAACTACCTCGAGGTAGTTGTTGCGGAGGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002686
PNMT MISSION shRNA shRNA Plasmid DNA
phenylethanolamine N-methyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-787s21c1
Sequence:CCGGCCAGATCTTGCCAGCTTTCAGCTCGAGCTGAAAGCTGGCAAGATCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000035589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-505s1c1
Sequence:CCGGGAGGACATCACCATGACAGATCTCGAGATCTGTCATGGTGATGTCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000035593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1000s1c1
Sequence:CCGGGCCCACCTTCAGACAGGCGTACTCGAGTACGCCTGTCTGAAGGTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000035592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-440s1c1
Sequence:CCGGGCACCCTCATCGACATTGGTTCTCGAGAACCAATGTCGATGAGGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000035590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1020s1c1
Sequence:CCGGAGATGATGTCAAGGGCGTCTTCTCGAGAAGACGCCCTTGACATCATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000035591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-948s1c1
Sequence:CCGGCCTGGTGCGTAGTGGCTACAACTCGAGTTGTAGCCACTACGCACCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000430241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-322s21c1
Sequence:CCGGGCCTACCTCCGCAACAACTACCTCGAGGTAGTTGTTGCGGAGGTAGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002686
PNMT MISSION shRNA Lentiviral Transduction Particles
phenylethanolamine N-methyltransferase
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000437152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-787s21c1
Sequence:CCGGCCAGATCTTGCCAGCTTTCAGCTCGAGCTGAAAGCTGGCAAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-505s1c1
Sequence:CCGGGAGGACATCACCATGACAGATCTCGAGATCTGTCATGGTGATGTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1000s1c1
Sequence:CCGGGCCCACCTTCAGACAGGCGTACTCGAGTACGCCTGTCTGAAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-440s1c1
Sequence:CCGGGCACCCTCATCGACATTGGTTCTCGAGAACCAATGTCGATGAGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-1020s1c1
Sequence:CCGGAGATGATGTCAAGGGCGTCTTCTCGAGAAGACGCCCTTGACATCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002686.2-948s1c1
Sequence:CCGGCCTGGTGCGTAGTGGCTACAACTCGAGTTGTAGCCACTACGCACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002686.3-322s21c1
Sequence:CCGGGCCTACCTCCGCAACAACTACCTCGAGGTAGTTGTTGCGGAGGTAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008890
PNMT MISSION shRNA Bacterial Glycerol Stock
phenylethanolamine N-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-392s1c1
Sequence:CCGGCCTTTGACTGGAGTGTGTATACTCGAGTATACACACTCCAGTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-391s1c1
Sequence:CCGGGCCTTTGACTGGAGTGTGTATCTCGAGATACACACTCCAGTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-597s1c1
Sequence:CCGGCCCAGATCTTACTAGCTTCCACTCGAGTGGAAGCTAGTAAGATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-330s1c1
Sequence:CCGGGACAGACTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-278s1c1
Sequence:CCGGCCACCATATATCAGCTGCTCACTCGAGTGAGCAGCTGATATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008890
PNMT MISSION shRNA shRNA Plasmid DNA
phenylethanolamine N-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-392s1c1
Sequence:CCGGCCTTTGACTGGAGTGTGTATACTCGAGTATACACACTCCAGTCAAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-391s1c1
Sequence:CCGGGCCTTTGACTGGAGTGTGTATCTCGAGATACACACTCCAGTCAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-597s1c1
Sequence:CCGGCCCAGATCTTACTAGCTTCCACTCGAGTGGAAGCTAGTAAGATCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-330s1c1
Sequence:CCGGGACAGACTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGTCTGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000097508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-278s1c1
Sequence:CCGGCCACCATATATCAGCTGCTCACTCGAGTGAGCAGCTGATATATGGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008890
PNMT MISSION shRNA Lentiviral Transduction Particles
phenylethanolamine N-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000097506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-392s1c1
Sequence:CCGGCCTTTGACTGGAGTGTGTATACTCGAGTATACACACTCCAGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-391s1c1
Sequence:CCGGGCCTTTGACTGGAGTGTGTATCTCGAGATACACACTCCAGTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-597s1c1
Sequence:CCGGCCCAGATCTTACTAGCTTCCACTCGAGTGGAAGCTAGTAAGATCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-330s1c1
Sequence:CCGGGACAGACTTCTTGGAAGTCAACTCGAGTTGACTTCCAAGAAGTCTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008890.1-278s1c1
Sequence:CCGGCCACCATATATCAGCTGCTCACTCGAGTGAGCAGCTGATATATGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)