EMAIL THIS PAGE TO A FRIEND

PNN

pinin, desmosome associated protein

89 Gene Product Result for
Synonyms: DRS DRSP SDK3 memA
Gene ID:
Mouse(18949) pinin
Rat(368070) pinin, desmosome associated protein
naked mole-rat(101716915) pinin, desmosome associated protein
domestic guinea pig(100714770) pinin, desmosome associated protein
cow(100296970) pinin, desmosome associated protein
sheep(101101925) pinin, desmosome associated protein
chicken(423338) pinin, desmosome associated protein
domestic cat(101087411) pinin, desmosome associated protein
dog(403907) pinin, desmosome associated protein
Zebrafish(407733) pinin, desmosome associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002687 Rosetta Predictions human pricing
NM_001109023 Rosetta Predictions rat pricing
NM_008891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106398 predicted 752
2 SASI_Hs01_00106399 predicted 461
3 SASI_Hs01_00106400 predicted 509
4 SASI_Hs02_00334250 predicted 903
5 SASI_Hs01_00106402 predicted 522
6 SASI_Hs01_00106404 predicted 470
7 SASI_Hs01_00106405 predicted 220
8 SASI_Hs02_00334251 predicted 2699
9 SASI_Hs01_00106407 predicted 250
10 SASI_Hs02_00334252 predicted 570
11 SASI_Hs01_00106401 predicted 499
12 SASI_Hs01_00106403 predicted 635
13 SASI_Hs01_00106406 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244414 predicted 315
2 SASI_Rn02_00244415 predicted 462
3 SASI_Rn02_00244416 predicted 387
4 SASI_Rn02_00244417 predicted 492
5 SASI_Rn02_00244418 predicted 369
6 SASI_Rn02_00244419 predicted 471
7 SASI_Rn02_00244420 predicted 354
8 SASI_Rn02_00244421 predicted 387
9 SASI_Rn02_00244422 predicted 438
10 SASI_Rn02_00244423 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102514 predicted 385
2 SASI_Mm02_00314902 predicted 932
3 SASI_Mm01_00102516 predicted 502
4 SASI_Mm01_00102517 predicted 896
5 SASI_Mm01_00102518 predicted 2209
6 SASI_Mm01_00102519 predicted 1257
7 SASI_Mm01_00102521 predicted 1273
8 SASI_Mm01_00102522 predicted 563
9 SASI_Mm01_00102523 predicted 1098
10 SASI_Mm02_00314903 predicted 522
11 SASI_Mm01_00102515 predicted 441
12 SASI_Mm01_00102520 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002687
VALIDATED
PNN MISSION shRNA Bacterial Glycerol Stock
pinin, desmosome associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-254s21c1
Sequence:CCGGGGTAGAGGACGTGGTAGTTTACTCGAGTAAACTACCACGTCCTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002687.3-2284s21c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-510s1c1
Sequence:CCGGCCGGCGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-2271s1c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-895s1c1
Sequence:CCGGCGCATCGAATTTGCAGAACAACTCGAGTTGTTCTGCAAATTCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-2138s1c1
Sequence:CCGGCCGACAGAAAGAGGTCTATATCTCGAGATATAGACCTCTTTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-896s1c1
Sequence:CCGGGCATCGAATTTGCAGAACAAACTCGAGTTTGTTCTGCAAATTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-464s21c1
Sequence:CCGGCGCACACGTAGAGACCTTATCCTCGAGGATAAGGTCTCTACGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-1050s21c1
Sequence:CCGGAGTTGGAGGAGACAGGTAATCCTCGAGGATTACCTGTCTCCTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-978s21c1
Sequence:CCGGAGCATCAGGTGGTGCGTAATGCTCGAGCATTACGCACCACCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002687
VALIDATED
PNN MISSION shRNA shRNA Plasmid DNA
pinin, desmosome associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-254s21c1
Sequence:CCGGGGTAGAGGACGTGGTAGTTTACTCGAGTAAACTACCACGTCCTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002687.3-2284s21c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-510s1c1
Sequence:CCGGCCGGCGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-2271s1c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-895s1c1
Sequence:CCGGCGCATCGAATTTGCAGAACAACTCGAGTTGTTCTGCAAATTCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-2138s1c1
Sequence:CCGGCCGACAGAAAGAGGTCTATATCTCGAGATATAGACCTCTTTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-896s1c1
Sequence:CCGGGCATCGAATTTGCAGAACAAACTCGAGTTTGTTCTGCAAATTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-464s21c1
Sequence:CCGGCGCACACGTAGAGACCTTATCCTCGAGGATAAGGTCTCTACGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-1050s21c1
Sequence:CCGGAGTTGGAGGAGACAGGTAATCCTCGAGGATTACCTGTCTCCTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-978s21c1
Sequence:CCGGAGCATCAGGTGGTGCGTAATGCTCGAGCATTACGCACCACCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002687
VALIDATED
PNN MISSION shRNA Lentiviral Transduction Particles
pinin, desmosome associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-254s21c1
Sequence:CCGGGGTAGAGGACGTGGTAGTTTACTCGAGTAAACTACCACGTCCTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002687.3-2284s21c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-510s1c1
Sequence:CCGGCCGGCGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-2271s1c1
Sequence:CCGGGCAGCAGAAGATTTCTTGATACTCGAGTATCAAGAAATCTTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-895s1c1
Sequence:CCGGCGCATCGAATTTGCAGAACAACTCGAGTTGTTCTGCAAATTCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002687.2-2138s1c1
Sequence:CCGGCCGACAGAAAGAGGTCTATATCTCGAGATATAGACCTCTTTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002687.2-896s1c1
Sequence:CCGGGCATCGAATTTGCAGAACAAACTCGAGTTTGTTCTGCAAATTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-464s21c1
Sequence:CCGGCGCACACGTAGAGACCTTATCCTCGAGGATAAGGTCTCTACGTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-1050s21c1
Sequence:CCGGAGTTGGAGGAGACAGGTAATCCTCGAGGATTACCTGTCTCCTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_002687.3-978s21c1
Sequence:CCGGAGCATCAGGTGGTGCGTAATGCTCGAGCATTACGCACCACCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008891
VALIDATED
PNN MISSION shRNA Bacterial Glycerol Stock
pinin, desmosome associated protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008891.1-1039s1c1
Sequence:CCGGGCAGGTATAGTTCATAGTGATCTCGAGATCACTATGAACTATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-1582s1c1
Sequence:CCGGCCTCAGGTTATTCAGGAGCAACTCGAGTTGCTCCTGAATAACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008891.1-2326s1c1
Sequence:CCGGGCTGTTTGTTTACCTGACATTCTCGAGAATGTCAGGTAAACAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-441s1c1
Sequence:CCGGCCGACGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-886s21c1
Sequence:CCGGGAAGGTAGACGCATCGAATTTCTCGAGAAATTCGATGCGTCTACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008891.2-2545s21c1
Sequence:CCGGTTCAGTCAGAATCCGTATATTCTCGAGAATATACGGATTCTGACTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-501s21c1
Sequence:CCGGGCAAAGGAACCGACGAATATTCTCGAGAATATTCGTCGGTTCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-1643s21c1
Sequence:CCGGAGCCTCCACCTCAGGTTATTCCTCGAGGAATAACCTGAGGTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-1264s21c1
Sequence:CCGGGAAAGTGTCAAACACGTAATTCTCGAGAATTACGTGTTTGACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008891
VALIDATED
PNN MISSION shRNA shRNA Plasmid DNA
pinin, desmosome associated protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008891.1-1039s1c1
Sequence:CCGGGCAGGTATAGTTCATAGTGATCTCGAGATCACTATGAACTATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-1582s1c1
Sequence:CCGGCCTCAGGTTATTCAGGAGCAACTCGAGTTGCTCCTGAATAACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008891.1-2326s1c1
Sequence:CCGGGCTGTTTGTTTACCTGACATTCTCGAGAATGTCAGGTAAACAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-441s1c1
Sequence:CCGGCCGACGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-886s21c1
Sequence:CCGGGAAGGTAGACGCATCGAATTTCTCGAGAAATTCGATGCGTCTACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008891.2-2545s21c1
Sequence:CCGGTTCAGTCAGAATCCGTATATTCTCGAGAATATACGGATTCTGACTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-501s21c1
Sequence:CCGGGCAAAGGAACCGACGAATATTCTCGAGAATATTCGTCGGTTCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-1643s21c1
Sequence:CCGGAGCCTCCACCTCAGGTTATTCCTCGAGGAATAACCTGAGGTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-1264s21c1
Sequence:CCGGGAAAGTGTCAAACACGTAATTCTCGAGAATTACGTGTTTGACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008891
VALIDATED
PNN MISSION shRNA Lentiviral Transduction Particles
pinin, desmosome associated protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008891.1-1039s1c1
Sequence:CCGGGCAGGTATAGTTCATAGTGATCTCGAGATCACTATGAACTATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-1582s1c1
Sequence:CCGGCCTCAGGTTATTCAGGAGCAACTCGAGTTGCTCCTGAATAACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008891.1-2326s1c1
Sequence:CCGGGCTGTTTGTTTACCTGACATTCTCGAGAATGTCAGGTAAACAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008891.1-441s1c1
Sequence:CCGGCCGACGAATATTTGGCTTGTTCTCGAGAACAAGCCAAATATTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-886s21c1
Sequence:CCGGGAAGGTAGACGCATCGAATTTCTCGAGAAATTCGATGCGTCTACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339718    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008891.2-2545s21c1
Sequence:CCGGTTCAGTCAGAATCCGTATATTCTCGAGAATATACGGATTCTGACTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-501s21c1
Sequence:CCGGGCAAAGGAACCGACGAATATTCTCGAGAATATTCGTCGGTTCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008891.2-1643s21c1
Sequence:CCGGAGCCTCCACCTCAGGTTATTCCTCGAGGAATAACCTGAGGTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008891.2-1264s21c1
Sequence:CCGGGAAAGTGTCAAACACGTAATTCTCGAGAATTACGTGTTTGACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)