EMAIL THIS PAGE TO A FRIEND

PNOC

prepronociceptin

85 Gene Product Result for
Synonyms: PPNOC
UniProtKB ID: Q13519, Q6FH16
Gene ID:
Mouse(18155) prepronociceptin
Rat(25516) prepronociceptin
naked mole-rat(101723459) prepronociceptin
cow(281414) prepronociceptin
sheep(100294608) prepronociceptin
sheep(101115683) prepronociceptin
chicken(422019) prepronociceptin
dog(486095) prepronociceptin
domestic cat(101094754) prepronociceptin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006228 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121961 MISSION® esiRNA esiRNA human PNOC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006228 Rosetta Predictions human pricing
NM_013007 Rosetta Predictions rat pricing
NM_010932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169373 predicted 882
2 SASI_Hs01_00169374 predicted 827
3 SASI_Hs01_00169375 predicted 645
4 SASI_Hs01_00169376 predicted 780
5 SASI_Hs01_00169377 predicted 557
6 SASI_Hs01_00169378 predicted 619
7 SASI_Hs01_00169379 predicted 645
8 SASI_Hs01_00169380 predicted 372
9 SASI_Hs01_00169381 predicted 941
10 SASI_Hs01_00169382 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085647 predicted 591
2 SASI_Rn01_00085648 predicted 540
3 SASI_Rn01_00085649 predicted 480
4 SASI_Rn01_00085650 predicted 634
5 SASI_Rn01_00085651 predicted 480
6 SASI_Rn01_00085652 predicted 332
7 SASI_Rn01_00085653 predicted 276
8 SASI_Rn01_00085654 predicted 744
9 SASI_Rn01_00085655 predicted 325
10 SASI_Rn01_00085656 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055733 predicted 351
2 SASI_Mm01_00055734 predicted 718
3 SASI_Mm01_00055735 predicted 573
4 SASI_Mm01_00055736 predicted 541
5 SASI_Mm01_00055737 predicted 593
6 SASI_Mm01_00055738 predicted 394
7 SASI_Mm01_00055740 predicted 836
8 SASI_Mm01_00055741 predicted 258
9 SASI_Mm01_00055742 predicted 223
10 SASI_Mm02_00319685 predicted 727
11 SASI_Mm01_00055739 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010932
PNOC MISSION shRNA Bacterial Glycerol Stock
prepronociceptin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-234s1c1
Sequence:CCGGCCAGTGTGAAGAGAAGGTCTTCTCGAGAAGACCTTCTCTTCACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-567s1c1
Sequence:CCGGGAAGCGGTTCAGTGAGTTTATCTCGAGATAAACTCACTGAACCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-265s1c1
Sequence:CCGGCTCTGGACTGTATGCACCAAACTCGAGTTTGGTGCATACAGTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-201s1c1
Sequence:CCGGTCCAGACAGCTTCAACTTAAACTCGAGTTTAAGTTGAAGCTGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010932.1-1555s1c1
Sequence:CCGGCCCAGCAGAATCTTATACATTCTCGAGAATGTATAAGATTCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010932
PNOC MISSION shRNA shRNA Plasmid DNA
prepronociceptin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-234s1c1
Sequence:CCGGCCAGTGTGAAGAGAAGGTCTTCTCGAGAAGACCTTCTCTTCACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-567s1c1
Sequence:CCGGGAAGCGGTTCAGTGAGTTTATCTCGAGATAAACTCACTGAACCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-265s1c1
Sequence:CCGGCTCTGGACTGTATGCACCAAACTCGAGTTTGGTGCATACAGTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-201s1c1
Sequence:CCGGTCCAGACAGCTTCAACTTAAACTCGAGTTTAAGTTGAAGCTGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010932.1-1555s1c1
Sequence:CCGGCCCAGCAGAATCTTATACATTCTCGAGAATGTATAAGATTCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010932
PNOC MISSION shRNA Lentiviral Transduction Particles
prepronociceptin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-234s1c1
Sequence:CCGGCCAGTGTGAAGAGAAGGTCTTCTCGAGAAGACCTTCTCTTCACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-567s1c1
Sequence:CCGGGAAGCGGTTCAGTGAGTTTATCTCGAGATAAACTCACTGAACCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-265s1c1
Sequence:CCGGCTCTGGACTGTATGCACCAAACTCGAGTTTGGTGCATACAGTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010932.1-201s1c1
Sequence:CCGGTCCAGACAGCTTCAACTTAAACTCGAGTTTAAGTTGAAGCTGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010932.1-1555s1c1
Sequence:CCGGCCCAGCAGAATCTTATACATTCTCGAGAATGTATAAGATTCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006228
PNOC MISSION shRNA Bacterial Glycerol Stock
prepronociceptin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-673s1c1
Sequence:CCGGGCAATACTTGGTCCTGAGCATCTCGAGATGCTCAGGACCAAGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-721s1c1
Sequence:CCGGGCACCAGAATGGTAATGTGTACTCGAGTACACATTACCATTCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.3-906s1c1
Sequence:CCGGCAGAACCTTCCCGTCTGATTGCTCGAGCAATCAGACGGGAAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.3-241s1c1
Sequence:CCGGCAGTCTCTTCTCCAGTGTGTTCTCGAGAACACACTGGAGAAGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-664s1c1
Sequence:CCGGGTTTATGAGGCAATACTTGGTCTCGAGACCAAGTATTGCCTCATAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-647s1c1
Sequence:CCGGCAGAAGCGGTTCAGTGAGTTTCTCGAGAAACTCACTGAACCGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-580s1c1
Sequence:CCGGGAAGCAGCTGCAGAAGAGATTCTCGAGAATCTCTTCTGCAGCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-658s1c1
Sequence:CCGGCAGTGAGTTTATGAGGCAATACTCGAGTATTGCCTCATAAACTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.2-998s1c1
Sequence:CCGGCCTCTAGCTACCATTTCAATACTCGAGTATTGAAATGGTAGCTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-674s1c1
Sequence:CCGGCAATACTTGGTCCTGAGCATGCTCGAGCATGCTCAGGACCAAGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006228
PNOC MISSION shRNA shRNA Plasmid DNA
prepronociceptin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-673s1c1
Sequence:CCGGGCAATACTTGGTCCTGAGCATCTCGAGATGCTCAGGACCAAGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-721s1c1
Sequence:CCGGGCACCAGAATGGTAATGTGTACTCGAGTACACATTACCATTCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.3-906s1c1
Sequence:CCGGCAGAACCTTCCCGTCTGATTGCTCGAGCAATCAGACGGGAAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.3-241s1c1
Sequence:CCGGCAGTCTCTTCTCCAGTGTGTTCTCGAGAACACACTGGAGAAGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-664s1c1
Sequence:CCGGGTTTATGAGGCAATACTTGGTCTCGAGACCAAGTATTGCCTCATAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-647s1c1
Sequence:CCGGCAGAAGCGGTTCAGTGAGTTTCTCGAGAAACTCACTGAACCGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-580s1c1
Sequence:CCGGGAAGCAGCTGCAGAAGAGATTCTCGAGAATCTCTTCTGCAGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-658s1c1
Sequence:CCGGCAGTGAGTTTATGAGGCAATACTCGAGTATTGCCTCATAAACTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.2-998s1c1
Sequence:CCGGCCTCTAGCTACCATTTCAATACTCGAGTATTGAAATGGTAGCTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-674s1c1
Sequence:CCGGCAATACTTGGTCCTGAGCATGCTCGAGCATGCTCAGGACCAAGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006228
PNOC MISSION shRNA Lentiviral Transduction Particles
prepronociceptin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-673s1c1
Sequence:CCGGGCAATACTTGGTCCTGAGCATCTCGAGATGCTCAGGACCAAGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-721s1c1
Sequence:CCGGGCACCAGAATGGTAATGTGTACTCGAGTACACATTACCATTCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.3-906s1c1
Sequence:CCGGCAGAACCTTCCCGTCTGATTGCTCGAGCAATCAGACGGGAAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.3-241s1c1
Sequence:CCGGCAGTCTCTTCTCCAGTGTGTTCTCGAGAACACACTGGAGAAGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-664s1c1
Sequence:CCGGGTTTATGAGGCAATACTTGGTCTCGAGACCAAGTATTGCCTCATAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-647s1c1
Sequence:CCGGCAGAAGCGGTTCAGTGAGTTTCTCGAGAAACTCACTGAACCGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-580s1c1
Sequence:CCGGGAAGCAGCTGCAGAAGAGATTCTCGAGAATCTCTTCTGCAGCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-658s1c1
Sequence:CCGGCAGTGAGTTTATGAGGCAATACTCGAGTATTGCCTCATAAACTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006228.2-998s1c1
Sequence:CCGGCCTCTAGCTACCATTTCAATACTCGAGTATTGAAATGGTAGCTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006228.2-674s1c1
Sequence:CCGGCAATACTTGGTCCTGAGCATGCTCGAGCATGCTCAGGACCAAGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)