EMAIL THIS PAGE TO A FRIEND

PNPLA1

patatin-like phospholipase domain containing 1

71 Gene Product Result for
Synonyms: ARCI10 dJ50J22.1
Gene ID:
Human(285848) Summary: The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(433091) patatin-like phospholipase domain containing 1
Rat(361812) patatin-like phospholipase domain containing 1
chicken(428259) patatin-like phospholipase domain containing 1
dog(481763) patatin-like phospholipase domain containing 1
Horse(100063661) patatin-like phospholipase domain containing 1
domestic cat(101091788) patatin-like phospholipase domain containing 1
cow(786888) patatin-like phospholipase domain containing 1
sheep(101120362) patatin-like phospholipase domain containing 1
domestic guinea pig(100728999) patatin-like phospholipase domain containing 1
naked mole-rat(101713574) patatin-like phospholipase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU193991 MISSION® esiRNA esiRNA targeting mouse Pnpla1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039725 Rosetta Predictions human pricing
NM_173676 Rosetta Predictions human pricing
XM_001078563 Rosetta Predictions rat pricing
XM_342105 Rosetta Predictions rat pricing
NM_001034885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068515 predicted 824
2 SASI_Hs01_00068516 predicted 999
3 SASI_Hs01_00068517 predicted 772
4 SASI_Hs01_00068518 predicted 897
5 SASI_Hs01_00068519 predicted 986
6 SASI_Hs01_00068520 predicted 998
7 SASI_Hs01_00068521 predicted 1022
8 SASI_Hs01_00068522 predicted 1024
9 SASI_Hs01_00068523 predicted 871
10 SASI_Hs01_00068524 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163706 predicted 706
2 SASI_Hs02_00368607 predicted 310
3 SASI_Hs02_00368608 predicted 1324
4 SASI_Hs02_00368609 predicted 373
5 SASI_Hs01_00163707 predicted 880
6 SASI_Hs02_00368610 predicted 1265
7 SASI_Hs02_00368611 predicted 1098
8 SASI_Hs02_00368612 predicted 1198
9 SASI_Hs02_00368613 predicted 559
10 SASI_Hs01_00163709 predicted 774
11 SASI_Hs01_00163708 predicted 662
12 SASI_Hs01_00163710 predicted 878
13 SASI_Hs01_00163711 predicted 886
14 SASI_Hs01_00163712 predicted 912
15 SASI_Hs01_00163713 predicted 910
16 SASI_Hs01_00163714 predicted 753
17 SASI_Hs01_00163715 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361249 predicted 1193
2 SASI_Rn02_00361250 predicted 616
3 SASI_Rn02_00361251 predicted 650
4 SASI_Rn02_00361252 predicted 421
5 SASI_Rn02_00361253 predicted 439
6 SASI_Rn02_00361254 predicted 1254
7 SASI_Rn02_00361255 predicted 244
8 SASI_Rn02_00361256 predicted 1618
9 SASI_Rn02_00361257 predicted 817
10 SASI_Rn02_00361258 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393754 predicted 203
2 SASI_Rn02_00393755 predicted 270
3 SASI_Rn02_00393756 predicted 702
4 SASI_Rn02_00393757 predicted 614
5 SASI_Rn02_00393758 predicted 427
6 SASI_Rn02_00393759 predicted 536
7 SASI_Rn02_00393760 predicted 435
8 SASI_Rn02_00393761 predicted 768
9 SASI_Rn02_00393762 predicted 246
10 SASI_Rn02_00393763 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195259 predicted 1159
2 SASI_Mm02_00289163 predicted 1451
3 SASI_Mm01_00195260 predicted 2163
4 SASI_Mm01_00195261 predicted 895
5 SASI_Mm01_00195262 predicted 1591
6 SASI_Mm01_00195263 predicted 2104
7 SASI_Mm01_00195264 predicted 1484
8 SASI_Mm01_00195265 predicted 1745
9 SASI_Mm01_00195266 predicted 1765
10 SASI_Mm01_00195267 predicted 1517
11 SASI_Mm01_00195268 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034885
PNPLA1 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2173s21c1
Sequence:CCGGAGAGTTTGGGTCACCTATAAACTCGAGTTTATAGGTGACCCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2014s21c1
Sequence:CCGGGGTCCTGGTGAGGATTCAAATCTCGAGATTTGAATCCTCACCAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034885.3-3041s21c1
Sequence:CCGGTAGCCAAATGGCTGGATTATACTCGAGTATAATCCAGCCATTTGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1519s21c1
Sequence:CCGGCAACCATCTGTATCGCCATTACTCGAGTAATGGCGATACAGATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1167s21c1
Sequence:CCGGGGTGATTCTGCAGGAATATTACTCGAGTAATATTCCTGCAGAATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034885
PNPLA1 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2173s21c1
Sequence:CCGGAGAGTTTGGGTCACCTATAAACTCGAGTTTATAGGTGACCCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2014s21c1
Sequence:CCGGGGTCCTGGTGAGGATTCAAATCTCGAGATTTGAATCCTCACCAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034885.3-3041s21c1
Sequence:CCGGTAGCCAAATGGCTGGATTATACTCGAGTATAATCCAGCCATTTGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1519s21c1
Sequence:CCGGCAACCATCTGTATCGCCATTACTCGAGTAATGGCGATACAGATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1167s21c1
Sequence:CCGGGGTGATTCTGCAGGAATATTACTCGAGTAATATTCCTGCAGAATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034885
PNPLA1 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2173s21c1
Sequence:CCGGAGAGTTTGGGTCACCTATAAACTCGAGTTTATAGGTGACCCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-2014s21c1
Sequence:CCGGGGTCCTGGTGAGGATTCAAATCTCGAGATTTGAATCCTCACCAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034885.3-3041s21c1
Sequence:CCGGTAGCCAAATGGCTGGATTATACTCGAGTATAATCCAGCCATTTGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1519s21c1
Sequence:CCGGCAACCATCTGTATCGCCATTACTCGAGTAATGGCGATACAGATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034885.3-1167s21c1
Sequence:CCGGGGTGATTCTGCAGGAATATTACTCGAGTAATATTCCTGCAGAATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173676
PNPLA1 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173676.1-1796s1c1
Sequence:CCGGGCTCACAATAAGTAGGTATTACTCGAGTAATACCTACTTATTGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1315s1c1
Sequence:CCGGCCTCTGGTTCATGTGAAGGAACTCGAGTTCCTTCACATGAACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1371s1c1
Sequence:CCGGTGAAGACTCAAACTGGGTGAACTCGAGTTCACCCAGTTTGAGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1337s1c1
Sequence:CCGGCCGTCAGCAAGCCTTATGTAACTCGAGTTACATAAGGCTTGCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-612s1c1
Sequence:CCGGCGATTACTACTACCGAGGGTACTCGAGTACCCTCGGTAGTAGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173676
PNPLA1 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173676.1-1796s1c1
Sequence:CCGGGCTCACAATAAGTAGGTATTACTCGAGTAATACCTACTTATTGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1315s1c1
Sequence:CCGGCCTCTGGTTCATGTGAAGGAACTCGAGTTCCTTCACATGAACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1371s1c1
Sequence:CCGGTGAAGACTCAAACTGGGTGAACTCGAGTTCACCCAGTTTGAGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1337s1c1
Sequence:CCGGCCGTCAGCAAGCCTTATGTAACTCGAGTTACATAAGGCTTGCTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-612s1c1
Sequence:CCGGCGATTACTACTACCGAGGGTACTCGAGTACCCTCGGTAGTAGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173676
PNPLA1 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173676.1-1796s1c1
Sequence:CCGGGCTCACAATAAGTAGGTATTACTCGAGTAATACCTACTTATTGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1315s1c1
Sequence:CCGGCCTCTGGTTCATGTGAAGGAACTCGAGTTCCTTCACATGAACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1371s1c1
Sequence:CCGGTGAAGACTCAAACTGGGTGAACTCGAGTTCACCCAGTTTGAGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-1337s1c1
Sequence:CCGGCCGTCAGCAAGCCTTATGTAACTCGAGTTACATAAGGCTTGCTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173676.1-612s1c1
Sequence:CCGGCGATTACTACTACCGAGGGTACTCGAGTACCCTCGGTAGTAGTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)