EMAIL THIS PAGE TO A FRIEND

PNPLA2

patatin-like phospholipase domain containing 2

60 Gene Product Result for
Synonyms: 1110001C14Rik ATGL PEDF-R TTS-2.2 TTS2 iPLA2zeta
Gene ID:
Human(57104) Summary: This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
Mouse(66853) patatin-like phospholipase domain containing 2
Rat(361676) patatin-like phospholipase domain containing 2
chicken(431066) patatin-like phospholipase domain containing 2
dog(611403) patatin-like phospholipase domain containing 2
domestic cat(101082263) patatin-like phospholipase domain containing 2
naked mole-rat(101701275) patatin-like phospholipase domain containing 2
domestic guinea pig(100732516) patatin-like phospholipase domain containing 2
cow(508493) patatin-like phospholipase domain containing 2
sheep(101123166) patatin-like phospholipase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035471 MISSION® esiRNA esiRNA human PNPLA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020376 Rosetta Predictions human pricing
NM_001108509 Rosetta Predictions rat pricing
NM_025802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225605 predicted 816
2 SASI_Hs01_00225606 predicted 619
3 SASI_Hs01_00225607 predicted 686
4 SASI_Hs01_00225608 predicted 721
5 SASI_Hs01_00225609 predicted 468
6 SASI_Hs01_00225610 predicted 396
7 SASI_Hs01_00225611 predicted 558
8 SASI_Hs01_00225613 predicted 609
9 SASI_Hs01_00225614 predicted 701
10 SASI_Hs02_00353335 predicted 785
11 SASI_Hs01_00225612 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239349 predicted 685
2 SASI_Rn02_00239350 predicted 1241
3 SASI_Rn02_00239351 predicted 637
4 SASI_Rn02_00239352 predicted 603
5 SASI_Rn02_00239353 predicted 530
6 SASI_Rn02_00239354 predicted 1110
7 SASI_Rn02_00239355 predicted 539
8 SASI_Rn02_00239356 predicted 746
9 SASI_Rn02_00239357 predicted 1256
10 SASI_Rn02_00239358 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033377 predicted 496
2 SASI_Mm01_00033378 predicted 922
3 SASI_Mm01_00033379 predicted 1062
4 SASI_Mm01_00033380 predicted 998
5 SASI_Mm01_00033381 predicted 810
6 SASI_Mm01_00033382 predicted 584
7 SASI_Mm01_00033383 predicted 465
8 SASI_Mm01_00033384 predicted 865
9 SASI_Mm01_00033385 predicted 1360
10 SASI_Mm01_00033386 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020376
PNPLA2 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020376.2-1952s1c1
Sequence:CCGGCCCTTTACTCCTGAGAACTTTCTCGAGAAAGTTCTCAGGAGTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-721s1c1
Sequence:CCGGGCCACTCTATGAGCTTAAGAACTCGAGTTCTTAAGCTCATAGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-577s1c1
Sequence:CCGGGAATGTCATTATATCCCACTTCTCGAGAAGTGGGATATAATGACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-402s1c1
Sequence:CCGGCCAAGTTCATTGAGGTATCTACTCGAGTAGATACCTCAATGAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-718s1c2
Sequence:CCGGCCTGCCACTCTATGAGCTTAACTCGAGTTAAGCTCATAGAGTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020376
PNPLA2 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020376.2-1952s1c1
Sequence:CCGGCCCTTTACTCCTGAGAACTTTCTCGAGAAAGTTCTCAGGAGTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-721s1c1
Sequence:CCGGGCCACTCTATGAGCTTAAGAACTCGAGTTCTTAAGCTCATAGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-577s1c1
Sequence:CCGGGAATGTCATTATATCCCACTTCTCGAGAAGTGGGATATAATGACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-402s1c1
Sequence:CCGGCCAAGTTCATTGAGGTATCTACTCGAGTAGATACCTCAATGAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-718s1c2
Sequence:CCGGCCTGCCACTCTATGAGCTTAACTCGAGTTAAGCTCATAGAGTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020376
PNPLA2 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020376.2-1952s1c1
Sequence:CCGGCCCTTTACTCCTGAGAACTTTCTCGAGAAAGTTCTCAGGAGTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-721s1c1
Sequence:CCGGGCCACTCTATGAGCTTAAGAACTCGAGTTCTTAAGCTCATAGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-577s1c1
Sequence:CCGGGAATGTCATTATATCCCACTTCTCGAGAAGTGGGATATAATGACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-402s1c1
Sequence:CCGGCCAAGTTCATTGAGGTATCTACTCGAGTAGATACCTCAATGAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020376.2-718s1c2
Sequence:CCGGCCTGCCACTCTATGAGCTTAACTCGAGTTAAGCTCATAGAGTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025802
VALIDATED
PNPLA2 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025802.1-515s1c1
Sequence:CCGGGCACATTTATCCCGGTGTACTCTCGAGAGTACACCGGGATAAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-425s21c1
Sequence:CCGGCATCTCCCTGACTCGTGTTTCCTCGAGGAAACACGAGTCAGGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-569s21c1
Sequence:CCGGCTATGTGGATGGCGGCATTTCCTCGAGGAAATGCCGCCATCCACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025802.2-448s21c1
Sequence:CCGGACGGAGAGAACGTCATCATATCTCGAGATATGATGACGTTCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-268s21c1
Sequence:CCGGGTGAAGCAGGTGCCAACATTACTCGAGTAATGTTGGCACCTGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-1488s21c1
Sequence:CCGGTGCTGTGGAATGAGGACATAGCTCGAGCTATGTCCTCATTCCACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025802
VALIDATED
PNPLA2 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025802.1-515s1c1
Sequence:CCGGGCACATTTATCCCGGTGTACTCTCGAGAGTACACCGGGATAAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-425s21c1
Sequence:CCGGCATCTCCCTGACTCGTGTTTCCTCGAGGAAACACGAGTCAGGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-569s21c1
Sequence:CCGGCTATGTGGATGGCGGCATTTCCTCGAGGAAATGCCGCCATCCACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025802.2-448s21c1
Sequence:CCGGACGGAGAGAACGTCATCATATCTCGAGATATGATGACGTTCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-268s21c1
Sequence:CCGGGTGAAGCAGGTGCCAACATTACTCGAGTAATGTTGGCACCTGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-1488s21c1
Sequence:CCGGTGCTGTGGAATGAGGACATAGCTCGAGCTATGTCCTCATTCCACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025802
VALIDATED
PNPLA2 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025802.1-515s1c1
Sequence:CCGGGCACATTTATCCCGGTGTACTCTCGAGAGTACACCGGGATAAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-425s21c1
Sequence:CCGGCATCTCCCTGACTCGTGTTTCCTCGAGGAAACACGAGTCAGGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-569s21c1
Sequence:CCGGCTATGTGGATGGCGGCATTTCCTCGAGGAAATGCCGCCATCCACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025802.2-448s21c1
Sequence:CCGGACGGAGAGAACGTCATCATATCTCGAGATATGATGACGTTCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-268s21c1
Sequence:CCGGGTGAAGCAGGTGCCAACATTACTCGAGTAATGTTGGCACCTGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025802.2-1488s21c1
Sequence:CCGGTGCTGTGGAATGAGGACATAGCTCGAGCTATGTCCTCATTCCACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)