EMAIL THIS PAGE TO A FRIEND

PNPLA6

patatin-like phospholipase domain containing 6

91 Gene Product Result for
Synonyms: NTE NTEMND SPG39 iPLA2delta sws
Gene ID:
Human(10908) Summary: This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(50767) patatin-like phospholipase domain containing 6
Rat(360753) patatin-like phospholipase domain containing 6
domestic guinea pig(100714197) patatin-like phospholipase domain containing 6
naked mole-rat(101724286) patatin-like phospholipase domain containing 6
cow(767822) patatin-like phospholipase domain containing 6
sheep(101123119) patatin-like phospholipase domain containing 6
Zebrafish(386860) patatin-like phospholipase domain containing 6
chicken(425396) patatin-like phospholipase domain containing 6
Horse(100060640) patatin-like phospholipase domain containing 6
domestic cat(101097705) patatin-like phospholipase domain containing 6
dog(484993) patatin-like phospholipase domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006702 Rosetta Predictions human pricing
XM_001057249 Rosetta Predictions rat pricing
XM_341025 Rosetta Predictions rat pricing
NM_001122818 Rosetta Predictions mouse pricing
NM_015801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117658 predicted 3674
2 SASI_Hs01_00117659 predicted 3838
3 SASI_Hs01_00117660 predicted 820
4 SASI_Hs01_00117661 predicted 4015
5 SASI_Hs01_00117663 predicted 3272
6 SASI_Hs02_00342126 predicted 2126
7 SASI_Hs01_00117665 predicted 565
8 SASI_Hs01_00117666 predicted 293
9 SASI_Hs01_00117667 predicted 459
10 SASI_Hs02_00342127 predicted 441
11 SASI_Hs01_00117662 predicted 4021
12 SASI_Hs01_00117664 predicted 3029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285825 predicted 3705
2 SASI_Rn02_00285826 predicted 1502
3 SASI_Rn02_00285827 predicted 3884
4 SASI_Rn02_00285828 predicted 3785
5 SASI_Rn02_00285829 predicted 1418
6 SASI_Rn02_00285830 predicted 2909
7 SASI_Rn02_00285831 predicted 4183
8 SASI_Rn02_00285832 predicted 1381
9 SASI_Rn02_00285833 predicted 1632
10 SASI_Rn02_00285834 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392250 predicted 3705
2 SASI_Rn02_00392251 predicted 1496
3 SASI_Rn02_00392252 predicted 3881
4 SASI_Rn02_00392253 predicted 3778
5 SASI_Rn02_00392254 predicted 1418
6 SASI_Rn02_00392255 predicted 2908
7 SASI_Rn02_00392256 predicted 4176
8 SASI_Rn02_00392257 predicted 1386
9 SASI_Rn02_00392258 predicted 1631
10 SASI_Rn02_00392259 predicted 3911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309429 predicted 1464
2 SASI_Mm02_00309430 predicted 3932
3 SASI_Mm02_00309431 predicted 2967
4 SASI_Mm02_00309432 predicted 2513
5 SASI_Mm02_00309433 predicted 3832
6 SASI_Mm02_00309434 predicted 1231
7 SASI_Mm02_00309435 predicted 1442
8 SASI_Mm02_00309436 predicted 2460
9 SASI_Mm02_00309437 predicted 2140
10 SASI_Mm02_00309438 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323171 predicted 1397
2 SASI_Mm01_00108550 predicted 3873
3 SASI_Mm01_00108551 predicted 2904
4 SASI_Mm01_00108552 predicted 2458
5 SASI_Mm01_00108553 predicted 3773
6 SASI_Mm01_00108554 predicted 1170
7 SASI_Mm01_00108555 predicted 1381
8 SASI_Mm01_00108556 predicted 2398
9 SASI_Mm01_00108558 predicted 2072
10 SASI_Mm02_00323172 predicted 979
11 SASI_Mm01_00108549 predicted 3723
12 SASI_Mm01_00108557 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006702
VALIDATED
PNPLA6 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-4310s1c1
Sequence:CCGGCTCCTGCTGCTATGCCTGTGACTCGAGTCACAGGCATAGCAGCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-3985s1c1
Sequence:CCGGGCAGAGATTGTGTCCCGGATTCTCGAGAATCCGGGACACAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-648s1c1
Sequence:CCGGGCCCTCTGAAGTGCTTTATATCTCGAGATATAAAGCACTTCAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-3877s1c1
Sequence:CCGGCGTGGCAACGTCATTGAGAAACTCGAGTTTCTCAATGACGTTGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-2094s1c1
Sequence:CCGGCTGCACTTACATCGTGCTCAACTCGAGTTGAGCACGATGTAAGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3942s21c1
Sequence:CCGGCGGCGGTCTACAGACCTTAATCTCGAGATTAAGGTCTGTAGACCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-449s21c1
Sequence:CCGGCTTCTATGGCCGGAAGATTATCTCGAGATAATCTTCCGGCCATAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-2884s21c1
Sequence:CCGGGCACCGTGGAGTGGCTAAATACTCGAGTATTTAGCCACTCCACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3107s21c1
Sequence:CCGGCTCGCACATCGGAGTACTAAACTCGAGTTTAGTACTCCGATGTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3844s21c1
Sequence:CCGGGGAAGTTCGACCAGATCTATGCTCGAGCATAGATCTGGTCGAACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006702
VALIDATED
PNPLA6 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-4310s1c1
Sequence:CCGGCTCCTGCTGCTATGCCTGTGACTCGAGTCACAGGCATAGCAGCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-3985s1c1
Sequence:CCGGGCAGAGATTGTGTCCCGGATTCTCGAGAATCCGGGACACAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-648s1c1
Sequence:CCGGGCCCTCTGAAGTGCTTTATATCTCGAGATATAAAGCACTTCAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-3877s1c1
Sequence:CCGGCGTGGCAACGTCATTGAGAAACTCGAGTTTCTCAATGACGTTGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-2094s1c1
Sequence:CCGGCTGCACTTACATCGTGCTCAACTCGAGTTGAGCACGATGTAAGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3942s21c1
Sequence:CCGGCGGCGGTCTACAGACCTTAATCTCGAGATTAAGGTCTGTAGACCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-449s21c1
Sequence:CCGGCTTCTATGGCCGGAAGATTATCTCGAGATAATCTTCCGGCCATAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-2884s21c1
Sequence:CCGGGCACCGTGGAGTGGCTAAATACTCGAGTATTTAGCCACTCCACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3107s21c1
Sequence:CCGGCTCGCACATCGGAGTACTAAACTCGAGTTTAGTACTCCGATGTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3844s21c1
Sequence:CCGGGGAAGTTCGACCAGATCTATGCTCGAGCATAGATCTGGTCGAACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006702
VALIDATED
PNPLA6 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-4310s1c1
Sequence:CCGGCTCCTGCTGCTATGCCTGTGACTCGAGTCACAGGCATAGCAGCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006702.2-3985s1c1
Sequence:CCGGGCAGAGATTGTGTCCCGGATTCTCGAGAATCCGGGACACAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-648s1c1
Sequence:CCGGGCCCTCTGAAGTGCTTTATATCTCGAGATATAAAGCACTTCAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-3877s1c1
Sequence:CCGGCGTGGCAACGTCATTGAGAAACTCGAGTTTCTCAATGACGTTGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006702.2-2094s1c1
Sequence:CCGGCTGCACTTACATCGTGCTCAACTCGAGTTGAGCACGATGTAAGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3942s21c1
Sequence:CCGGCGGCGGTCTACAGACCTTAATCTCGAGATTAAGGTCTGTAGACCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-449s21c1
Sequence:CCGGCTTCTATGGCCGGAAGATTATCTCGAGATAATCTTCCGGCCATAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-2884s21c1
Sequence:CCGGGCACCGTGGAGTGGCTAAATACTCGAGTATTTAGCCACTCCACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3107s21c1
Sequence:CCGGCTCGCACATCGGAGTACTAAACTCGAGTTTAGTACTCCGATGTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006702.3-3844s21c1
Sequence:CCGGGGAAGTTCGACCAGATCTATGCTCGAGCATAGATCTGGTCGAACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015801
VALIDATED
PNPLA6 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-4218s1c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-2293s1c1
Sequence:CCGGCCCGCCTTATTCATCTGCTAACTCGAGTTAGCAGATGAATAAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-1390s1c1
Sequence:CCGGCCTATGAACGTGGACGGATATCTCGAGATATCCGTCCACGTTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3216s1c1
Sequence:CCGGCCTGTATTGGACCTCACATATCTCGAGATATGTGAGGTCCAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3215s1c1
Sequence:CCGGGCCTGTATTGGACCTCACATACTCGAGTATGTGAGGTCCAATACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-3487s21c1
Sequence:CCGGACAACCTGCCAGCGGATATTGCTCGAGCAATATCCGCTGGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-2283s21c1
Sequence:CCGGCAGGTTGTGACCCGCCTTATTCTCGAGAATAAGGCGGGTCACAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1391s21c1
Sequence:CCGGCTATGAACGTGGACGGATATCCTCGAGGATATCCGTCCACGTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015801.2-4218s21c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1774s21c1
Sequence:CCGGCTGAGGAAGTGTGCCTATTTGCTCGAGCAAATAGGCACACTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015801
VALIDATED
PNPLA6 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-4218s1c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-2293s1c1
Sequence:CCGGCCCGCCTTATTCATCTGCTAACTCGAGTTAGCAGATGAATAAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-1390s1c1
Sequence:CCGGCCTATGAACGTGGACGGATATCTCGAGATATCCGTCCACGTTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3216s1c1
Sequence:CCGGCCTGTATTGGACCTCACATATCTCGAGATATGTGAGGTCCAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3215s1c1
Sequence:CCGGGCCTGTATTGGACCTCACATACTCGAGTATGTGAGGTCCAATACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-3487s21c1
Sequence:CCGGACAACCTGCCAGCGGATATTGCTCGAGCAATATCCGCTGGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-2283s21c1
Sequence:CCGGCAGGTTGTGACCCGCCTTATTCTCGAGAATAAGGCGGGTCACAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1391s21c1
Sequence:CCGGCTATGAACGTGGACGGATATCCTCGAGGATATCCGTCCACGTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015801.2-4218s21c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1774s21c1
Sequence:CCGGCTGAGGAAGTGTGCCTATTTGCTCGAGCAAATAGGCACACTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015801
VALIDATED
PNPLA6 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-4218s1c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-2293s1c1
Sequence:CCGGCCCGCCTTATTCATCTGCTAACTCGAGTTAGCAGATGAATAAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-1390s1c1
Sequence:CCGGCCTATGAACGTGGACGGATATCTCGAGATATCCGTCCACGTTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3216s1c1
Sequence:CCGGCCTGTATTGGACCTCACATATCTCGAGATATGTGAGGTCCAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015801.1-3215s1c1
Sequence:CCGGGCCTGTATTGGACCTCACATACTCGAGTATGTGAGGTCCAATACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-3487s21c1
Sequence:CCGGACAACCTGCCAGCGGATATTGCTCGAGCAATATCCGCTGGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-2283s21c1
Sequence:CCGGCAGGTTGTGACCCGCCTTATTCTCGAGAATAAGGCGGGTCACAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1391s21c1
Sequence:CCGGCTATGAACGTGGACGGATATCCTCGAGGATATCCGTCCACGTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015801.2-4218s21c1
Sequence:CCGGCCTGTTCCTAGACTGGGTTATCTCGAGATAACCCAGTCTAGGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015801.2-1774s21c1
Sequence:CCGGCTGAGGAAGTGTGCCTATTTGCTCGAGCAAATAGGCACACTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)