EMAIL THIS PAGE TO A FRIEND

PNPLA7

patatin-like phospholipase domain containing 7

51 Gene Product Result for
Synonyms: C9orf111 NTE-R1 NTEL1
Gene ID:
Human(375775) Summary: Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]
Mouse(241274) patatin-like phospholipase domain containing 7
Rat(246246) patatin-like phospholipase domain containing 7
chicken(427774) patatin-like phospholipase domain containing 7
Horse(100059297) patatin-like phospholipase domain containing 7
domestic cat(101086099) patatin-like phospholipase domain containing 7
dog(480663) patatin-like phospholipase domain containing 7
cow(536255) patatin-like phospholipase domain containing 7
sheep(101102716) patatin-like phospholipase domain containing 7
naked mole-rat(101702884) patatin-like phospholipase domain containing 7
domestic guinea pig(100712936) patatin-like phospholipase domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098537 Rosetta Predictions human pricing
NM_152286 Rosetta Predictions human pricing
NM_144738 Rosetta Predictions rat pricing
NM_146251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319406 predicted 2690
2 SASI_Hs02_00319407 predicted 1366
3 SASI_Hs02_00319408 predicted 1484
4 SASI_Hs02_00319409 predicted 682
5 SASI_Hs02_00319410 predicted 699
6 SASI_Hs02_00319411 predicted 4125
7 SASI_Hs02_00319412 predicted 779
8 SASI_Hs02_00319413 predicted 3720
9 SASI_Hs02_00319414 predicted 3449
10 SASI_Hs02_00319415 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087639 predicted 2623
2 SASI_Hs01_00087638 predicted 1287
3 SASI_Hs02_00365832 predicted 1410
4 SASI_Hs01_00087641 predicted 611
5 SASI_Hs02_00365833 predicted 619
6 SASI_Hs01_00087642 predicted 4049
7 SASI_Hs02_00365834 predicted 703
8 SASI_Hs01_00087644 predicted 3637
9 SASI_Hs02_00365835 predicted 3381
10 SASI_Hs02_00365836 predicted 706
11 SASI_Hs01_00087640 predicted 1021
12 SASI_Hs01_00087643 predicted 284
13 SASI_Hs01_00087645 predicted 325
14 SASI_Hs01_00087646 predicted 1460
15 SASI_Hs01_00087647 predicted 3964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268611 predicted 2428
2 SASI_Rn02_00268612 predicted 3623
3 SASI_Rn02_00268613 predicted 2826
4 SASI_Rn02_00268614 predicted 3856
5 SASI_Rn02_00268615 predicted 1402
6 SASI_Rn02_00268616 predicted 4049
7 SASI_Rn02_00268617 predicted 1074
8 SASI_Rn02_00268618 predicted 4026
9 SASI_Rn02_00268619 predicted 2679
10 SASI_Rn02_00268620 predicted 3284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026335 predicted 664
2 SASI_Mm01_00026336 predicted 1042
3 SASI_Mm01_00026337 predicted 3833
4 SASI_Mm01_00026338 predicted 406
5 SASI_Mm01_00026339 predicted 4019
6 SASI_Mm01_00026340 predicted 529
7 SASI_Mm01_00026341 predicted 717
8 SASI_Mm01_00026342 predicted 1620
9 SASI_Mm01_00026343 predicted 2802
10 SASI_Mm01_00026344 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152286
PNPLA7 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1010s21c1
Sequence:CCGGGGCCATGCTGCACCTTACAAACTCGAGTTTGTAAGGTGCAGCATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-599s21c1
Sequence:CCGGAGGACCAAGGTGCTGTCTTTGCTCGAGCAAAGACAGCACCTTGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-3517s21c1
Sequence:CCGGCATGTCCCTGTCCGGTTACATCTCGAGATGTAACCGGACAGGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-340s1c1
Sequence:CCGGGAAGAGAGACAAAGTGATGTTCTCGAGAACATCACTTTGTCTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3907s1c1
Sequence:CCGGCGAAATTGTGTCTCGCATTGACTCGAGTCAATGCGAGACACAATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-435s21c1
Sequence:CCGGTCAGAAGGCTTAGACAATTTCCTCGAGGAAATTGTCTAAGCCTTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-2254s1c1
Sequence:CCGGGATTCATCTCTTGGGTGAGAACTCGAGTTCTCACCCAAGAGATGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3595s1c1
Sequence:CCGGGAAAGTCAAGGTGTTGAACATCTCGAGATGTTCAACACCTTGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-1261s1c1
Sequence:CCGGGCCTTCCATTCGCAAACAGATCTCGAGATCTGTTTGCGAATGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-622s21c1
Sequence:CCGGCAAGAGGATTCTGCGTTTCAACTCGAGTTGAAACGCAGAATCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1292s21c1
Sequence:CCGGGGCGAAGAAGAGCGGCTTAAACTCGAGTTTAAGCCGCTCTTCTTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152286
PNPLA7 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1010s21c1
Sequence:CCGGGGCCATGCTGCACCTTACAAACTCGAGTTTGTAAGGTGCAGCATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-599s21c1
Sequence:CCGGAGGACCAAGGTGCTGTCTTTGCTCGAGCAAAGACAGCACCTTGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-3517s21c1
Sequence:CCGGCATGTCCCTGTCCGGTTACATCTCGAGATGTAACCGGACAGGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-340s1c1
Sequence:CCGGGAAGAGAGACAAAGTGATGTTCTCGAGAACATCACTTTGTCTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3907s1c1
Sequence:CCGGCGAAATTGTGTCTCGCATTGACTCGAGTCAATGCGAGACACAATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-435s21c1
Sequence:CCGGTCAGAAGGCTTAGACAATTTCCTCGAGGAAATTGTCTAAGCCTTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-2254s1c1
Sequence:CCGGGATTCATCTCTTGGGTGAGAACTCGAGTTCTCACCCAAGAGATGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3595s1c1
Sequence:CCGGGAAAGTCAAGGTGTTGAACATCTCGAGATGTTCAACACCTTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-1261s1c1
Sequence:CCGGGCCTTCCATTCGCAAACAGATCTCGAGATCTGTTTGCGAATGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-622s21c1
Sequence:CCGGCAAGAGGATTCTGCGTTTCAACTCGAGTTGAAACGCAGAATCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1292s21c1
Sequence:CCGGGGCGAAGAAGAGCGGCTTAAACTCGAGTTTAAGCCGCTCTTCTTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152286
PNPLA7 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1010s21c1
Sequence:CCGGGGCCATGCTGCACCTTACAAACTCGAGTTTGTAAGGTGCAGCATGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-599s21c1
Sequence:CCGGAGGACCAAGGTGCTGTCTTTGCTCGAGCAAAGACAGCACCTTGGTCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-3517s21c1
Sequence:CCGGCATGTCCCTGTCCGGTTACATCTCGAGATGTAACCGGACAGGGACATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-340s1c1
Sequence:CCGGGAAGAGAGACAAAGTGATGTTCTCGAGAACATCACTTTGTCTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3907s1c1
Sequence:CCGGCGAAATTGTGTCTCGCATTGACTCGAGTCAATGCGAGACACAATTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-435s21c1
Sequence:CCGGTCAGAAGGCTTAGACAATTTCCTCGAGGAAATTGTCTAAGCCTTCTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-2254s1c1
Sequence:CCGGGATTCATCTCTTGGGTGAGAACTCGAGTTCTCACCCAAGAGATGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-3595s1c1
Sequence:CCGGGAAAGTCAAGGTGTTGAACATCTCGAGATGTTCAACACCTTGACTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152286.2-1261s1c1
Sequence:CCGGGCCTTCCATTCGCAAACAGATCTCGAGATCTGTTTGCGAATGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-622s21c1
Sequence:CCGGCAAGAGGATTCTGCGTTTCAACTCGAGTTGAAACGCAGAATCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152286.3-1292s21c1
Sequence:CCGGGGCGAAGAAGAGCGGCTTAAACTCGAGTTTAAGCCGCTCTTCTTCGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146251
PNPLA7 MISSION shRNA Bacterial Glycerol Stock
patatin-like phospholipase domain containing 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-610s21c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-1737s21c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-2864s21c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-3497s21c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146251.4-4361s21c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146251.2-4307s1c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-556s1c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-3443s1c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-2810s1c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-1683s1c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146251
PNPLA7 MISSION shRNA shRNA Plasmid DNA
patatin-like phospholipase domain containing 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-610s21c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-1737s21c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-2864s21c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-3497s21c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146251.4-4361s21c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146251.2-4307s1c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-556s1c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-3443s1c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-2810s1c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-1683s1c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146251
PNPLA7 MISSION shRNA Lentiviral Transduction Particles
patatin-like phospholipase domain containing 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-610s21c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-1737s21c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-2864s21c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146251.4-3497s21c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146251.4-4361s21c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146251.2-4307s1c1
Sequence:CCGGCCCATTCCTTAGAGGCTACTTCTCGAGAAGTAGCCTCTAAGGAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-556s1c1
Sequence:CCGGCCAAGAGGATTCTGCGCTTTACTCGAGTAAAGCGCAGAATCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-3443s1c1
Sequence:CCGGCATGTCCTTGTCAGGCTATATCTCGAGATATAGCCTGACAAGGACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-2810s1c1
Sequence:CCGGGCAGCTAATCTTGCTGCACAACTCGAGTTGTGCAGCAAGATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146251.2-1683s1c1
Sequence:CCGGCGGGTGGCATTTCTTCATGTTCTCGAGAACATGAAGAAATGCCACCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)