EMAIL THIS PAGE TO A FRIEND

PNPO

pyridoxamine 5'-phosphate oxidase

50 Gene Product Result for
Synonyms: PDXPO
UniProtKB ID: Q9NVS9, D3DTT9
Gene ID:
Human(55163) Summary: The enzyme encoded by this gene catalyzes the terminal, rate-limiting step in the synthesis of pyridoxal 5'-phosphate, also known as vitamin B6. Vitamin B6 is a required co-factor for enzymes involved in both homocysteine metabolism and synthesis of neurotransmitters such as catecholamine. Mutations in this gene result in pyridoxamine 5'-phosphate oxidase (PNPO) deficiency, a form of neonatal epileptic encephalopathy. [provided by RefSeq, Oct 2008]
Mouse(103711) pyridoxine 5'-phosphate oxidase
Rat(64533) pyridoxamine 5'-phosphate oxidase
cow(512573) pyridoxamine 5'-phosphate oxidase
sheep(101117174) pyridoxamine 5'-phosphate oxidase
naked mole-rat(101702026) pyridoxamine 5'-phosphate oxidase
domestic guinea pig(100718098) pyridoxamine 5'-phosphate oxidase
Zebrafish(402868) pyridoxine 5'-phosphate oxidase
dog(480540) pyridoxamine 5'-phosphate oxidase
chicken(100857383) pyridoxamine 5'-phosphate oxidase
domestic cat(101085004) pyridoxamine 5'-phosphate oxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018129 Rosetta Predictions human pricing
NM_022601 Rosetta Predictions rat pricing
NM_134021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068078 predicted 1058
2 SASI_Hs01_00068079 predicted 1149
3 SASI_Hs02_00351341 predicted 484
4 SASI_Hs01_00068081 predicted 431
5 SASI_Hs01_00068082 predicted 514
6 SASI_Hs01_00068083 predicted 1245
7 SASI_Hs02_00351342 predicted 1078
8 SASI_Hs01_00068084 predicted 408
9 SASI_Hs01_00068085 predicted 1158
10 SASI_Hs02_00351343 predicted 793
11 SASI_Hs01_00068077 predicted 247
12 SASI_Hs01_00068080 predicted 1067
13 SASI_Hs01_00068086 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263350 predicted 550
2 SASI_Rn02_00263351 predicted 335
3 SASI_Rn02_00263352 predicted 439
4 SASI_Rn02_00263353 predicted 295
5 SASI_Rn02_00263354 predicted 438
6 SASI_Rn02_00263355 predicted 319
7 SASI_Rn02_00263356 predicted 229
8 SASI_Rn02_00263357 predicted 269
9 SASI_Rn02_00263358 predicted 331
10 SASI_Rn02_00263359 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138540 predicted 1076
2 SASI_Mm01_00138542 predicted 1025
3 SASI_Mm01_00138543 predicted 1248
4 SASI_Mm01_00138544 predicted 326
5 SASI_Mm01_00138545 predicted 286
6 SASI_Mm01_00138546 predicted 305
7 SASI_Mm01_00138547 predicted 1031
8 SASI_Mm01_00138548 predicted 509
9 SASI_Mm01_00138549 predicted 435
10 SASI_Mm02_00339179 predicted 1417
11 SASI_Mm01_00138541 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134021
VALIDATED
PNPO MISSION shRNA Bacterial Glycerol Stock
pyridoxamine 5'-phosphate oxidase
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1034s21c1
Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1283s21c1
Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-357s21c1
Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-254s21c1
Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-318s21c1
Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-467s21c1
Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-610s21c1
Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-444s21c1
Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134021.1-1357s1c1
Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-855s1c1
Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-1285s1c1
Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-465s1c1
Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-847s1c1
Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-411s1c1
Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-631s1c1
Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-413s1c1
Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134021
VALIDATED
PNPO MISSION shRNA shRNA Plasmid DNA
pyridoxamine 5'-phosphate oxidase
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1034s21c1
Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1283s21c1
Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-357s21c1
Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-254s21c1
Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-318s21c1
Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-467s21c1
Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-610s21c1
Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-444s21c1
Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134021.1-1357s1c1
Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-855s1c1
Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-1285s1c1
Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-465s1c1
Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-847s1c1
Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-411s1c1
Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-631s1c1
Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-413s1c1
Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134021
VALIDATED
PNPO MISSION shRNA Lentiviral Transduction Particles
pyridoxamine 5'-phosphate oxidase
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1034s21c1
Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-1283s21c1
Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-357s21c1
Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-254s21c1
Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134021.2-318s21c1
Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-467s21c1
Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-610s21c1
Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134021.2-444s21c1
Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134021.1-1357s1c1
Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-855s1c1
Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-1285s1c1
Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134021.1-465s1c1
Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-847s1c1
Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-411s1c1
Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-631s1c1
Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134021.1-413s1c1
Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018129
VALIDATED
PNPO MISSION shRNA Bacterial Glycerol Stock
pyridoxamine 5'-phosphate oxidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-511s21c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-289s21c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-917s21c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-673s21c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-343s21c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-241s1c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-463s1c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-869s1c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-295s1c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-625s1c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018129
VALIDATED
PNPO MISSION shRNA shRNA Plasmid DNA
pyridoxamine 5'-phosphate oxidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-511s21c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-289s21c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-917s21c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-673s21c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-343s21c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-241s1c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-463s1c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-869s1c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-295s1c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-625s1c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018129
VALIDATED
PNPO MISSION shRNA Lentiviral Transduction Particles
pyridoxamine 5'-phosphate oxidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-511s21c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-289s21c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-917s21c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-673s21c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018129.3-343s21c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-241s1c1
Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-463s1c1
Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-869s1c1
Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-295s1c1
Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018129.1-625s1c1
Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)