PNPO

pyridoxamine 5'-phosphate oxidase

46 Gene Product Result for

Synonyms: PDXPO

Species: Human PNPO(55163), Mouse Pnpo(103711), Rat Pnpo(64533), cow PNPO(512573), sheep PNPO(101117174), naked mole-rat Pnpo(101702026), domestic guinea pig Pnpo(100718098), Zebrafish pnpo(402868), dog PNPO(480540), chicken PNPO(100857383), domestic cat PNPO(101085004)

UniProtKB ID: Q9NVS9, D3DTT9

Gene ID:

Human(55163) Summary: The enzyme encoded by this gene catalyzes the terminal, rate-limiting step in the synthesis of pyridoxal 5'-phosphate, also known as vitamin B6. Vitamin B6 is a required co-factor for enzymes involved in both homocysteine metabolism and synthesis of neurotransmitters such as catecholamine. Mutations in this gene result in pyridoxamine 5'-phosphate oxidase (PNPO) deficiency, a form of neonatal epileptic encephalopathy. [provided by RefSeq, Oct 2008]

Mouse(103711) pyridoxine 5'-phosphate oxidase

Rat(64533) pyridoxamine 5'-phosphate oxidase

cow(512573) pyridoxamine 5'-phosphate oxidase

sheep(101117174) pyridoxamine 5'-phosphate oxidase

naked mole-rat(101702026) pyridoxamine 5'-phosphate oxidase

domestic guinea pig(100718098) pyridoxamine 5'-phosphate oxidase

Zebrafish(402868) pyridoxine 5'-phosphate oxidase

dog(480540) pyridoxamine 5'-phosphate oxidase

chicken(100857383) pyridoxamine 5'-phosphate oxidase

domestic cat(101085004) pyridoxamine 5'-phosphate oxidase

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1407625	Anti-PNPO antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

HPA027776	Anti-PNPO antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB2101836	Anti-PNPO antibody produced in rabbit affinity isolated antibody	horse, rat, human, mouse	western blot	pricing

HPA023204	Anti-PNPO antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB1411034	Anti-PNPO antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST75549	PrEST Antigen PNPO Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST75550	PrEST Antigen PNPO Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST37468	SILu^™PrEST PNPO SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST37469	SILu^™PrEST PNPO SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR11507	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, PNPO	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_134021	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_134021	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_134021	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_018129	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_018129	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_018129	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU019121	MISSION^® esiRNA esiRNA targeting human PNPO (esiRNA1)	human	pricing

EMU064221	MISSION^® esiRNA esiRNA targeting mouse Pnpo (esiRNA1)	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_018129	Rosetta Predictions	human	pricing
NM_022601	Rosetta Predictions	rat	pricing
NM_134021	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_018129	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00068078 predicted	1058
2	SASI_Hs01_00068079 predicted	1149
3	SASI_Hs02_00351341 predicted	484
4	SASI_Hs01_00068081 predicted	431
5	SASI_Hs01_00068082 predicted	514
6	SASI_Hs01_00068083 predicted	1245
7	SASI_Hs02_00351342 predicted	1078
8	SASI_Hs01_00068084 predicted	408
9	SASI_Hs01_00068085 predicted	1158
10	SASI_Hs02_00351343 predicted	793
11	SASI_Hs01_00068077 predicted	247
12	SASI_Hs01_00068080 predicted	1067
13	SASI_Hs01_00068086 predicted	205

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_022601	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00263350 predicted	550
2	SASI_Rn02_00263351 predicted	335
3	SASI_Rn02_00263352 predicted	439
4	SASI_Rn02_00263353 predicted	295
5	SASI_Rn02_00263354 predicted	438
6	SASI_Rn02_00263355 predicted	319
7	SASI_Rn02_00263356 predicted	229
8	SASI_Rn02_00263357 predicted	269
9	SASI_Rn02_00263358 predicted	331
10	SASI_Rn02_00263359 predicted	559

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_134021	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00138540 predicted	1076
2	SASI_Mm01_00138542 predicted	1025
3	SASI_Mm01_00138543 predicted	1248
4	SASI_Mm01_00138544 predicted	326
5	SASI_Mm01_00138545 predicted	286
6	SASI_Mm01_00138546 predicted	305
7	SASI_Mm01_00138547 predicted	1031
8	SASI_Mm01_00138548 predicted	509
9	SASI_Mm01_00138549 predicted	435
10	SASI_Mm02_00339179 predicted	1417
11	SASI_Mm01_00138541 predicted	629

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_134021 VALIDATED	PNPO MISSION shRNA Bacterial Glycerol Stock pyridoxamine 5'-phosphate oxidase	Mouse

16 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000374909
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1034s21c1
	Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366176
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1283s21c1
	Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374870
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-610s21c1
	Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366242
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-467s21c1
	Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366243
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-318s21c1
	Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000177480
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-1285s1c1
	Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178001
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-855s1c1
	Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178707
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-465s1c1
	Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200068
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-631s1c1
	Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200167
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-411s1c1
	Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200365
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-847s1c1
	Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374806
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-444s21c1
	Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-357s21c1
	Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000182098
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_134021.1-1357s1c1
	Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000198263
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-413s1c1
	Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366244
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-254s21c1
	Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_134021 VALIDATED	PNPO MISSION shRNA shRNA Plasmid DNA pyridoxamine 5'-phosphate oxidase	Mouse

16 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000374909
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1034s21c1
	Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366176
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1283s21c1
	Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374870
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-610s21c1
	Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366242
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-467s21c1
	Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366243
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-318s21c1
	Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000177480
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-1285s1c1
	Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178001
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-855s1c1
	Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178707
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-465s1c1
	Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200068
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-631s1c1
	Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200167
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-411s1c1
	Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200365
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-847s1c1
	Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374806
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-444s21c1
	Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-357s21c1
	Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000182098
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_134021.1-1357s1c1
	Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000198263
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-413s1c1
	Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366244
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-254s21c1
	Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_134021 VALIDATED	PNPO MISSION shRNA Lentiviral Transduction Particles pyridoxamine 5'-phosphate oxidase	Mouse

16 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000374909
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.76	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1034s21c1
	Sequence:CCGGGTGTGTGGCGCTGGGTTTAAACTCGAGTTTAAACCCAGCGCCACACACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366176
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.62	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-1283s21c1
	Sequence:CCGGAGTCCCTGGAGTAGTTGATTCCTCGAGGAATCAACTACTCCAGGGACTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374870
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-610s21c1
	Sequence:CCGGGGCCGAGAACTACTTCCATTCCTCGAGGAATGGAAGTAGTTCTCGGCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366242
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-467s21c1
	Sequence:CCGGGGCTTCCGCTTCTTCACTAACCTCGAGGTTAGTGAAGAAGCGGAAGCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366243
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-318s21c1
	Sequence:CCGGTGGATCCCATGAAGCAGTTTGCTCGAGCAAACTGCTTCATGGGATCCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000177480
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-1285s1c1
	Sequence:CCGGGCTAAGCCATTTCCTTTCTTACTCGAGTAAGAAAGGAAATGGCTTAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178001
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-855s1c1
	Sequence:CCGGGTATGAGAGACTTGCACCTTACTCGAGTAAGGTGCAAGTCTCTCATACTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000178707
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.51	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_134021.1-465s1c1
	Sequence:CCGGCTTTGCCTCTCTTGTCTTCTACTCGAGTAGAAGACAAGAGAGGCAAAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200068
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-631s1c1
	Sequence:CCGGCGGGAGTACCTGAGAAAGAAACTCGAGTTTCTTTCTCAGGTACTCCCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200167
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-411s1c1
	Sequence:CCGGCCGCTTCTTCACTAACTACGACTCGAGTCGTAGTTAGTGAAGAAGCGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200365
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-847s1c1
	Sequence:CCGGGACTGGGTGTATGAGAGACTTCTCGAGAAGTCTCTCATACACCCAGTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000374806
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-444s21c1
	Sequence:CCGGTGCTGAAGGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCCTTCAGCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366175
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_134021.2-357s21c1
	Sequence:CCGGCTGTTCAGTGTCCGGACATAGCTCGAGCTATGTCCGGACACTGAACAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000182098
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_134021.1-1357s1c1
	Sequence:CCGGCGAATCAGTTAGTGGCTGGAACTCGAGTTCCAGCCACTAACTGATTCGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000198263
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134021.1-413s1c1
	Sequence:CCGGGCTTCTTCACTAACTACGAGACTCGAGTCTCGTAGTTAGTGAAGAAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366244
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134021.2-254s21c1
	Sequence:CCGGGGACCAATGCGCAAGAGTTACCTCGAGGTAACTCTTGCGCATTGGTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_018129 VALIDATED	PNPO MISSION shRNA Bacterial Glycerol Stock pyridoxamine 5'-phosphate oxidase	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331392
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-343s21c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300812
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-917s21c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300744
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-511s21c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300811
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-673s21c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046029
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-295s1c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-241s1c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-869s1c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046032
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-463s1c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-625s1c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300814
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-289s21c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_018129 VALIDATED	PNPO MISSION shRNA shRNA Plasmid DNA pyridoxamine 5'-phosphate oxidase	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331392
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-343s21c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300812
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-917s21c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300744
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-511s21c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300811
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-673s21c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046029
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-295s1c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-241s1c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-869s1c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046032
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-463s1c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-625s1c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300814
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-289s21c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_018129 VALIDATED	PNPO MISSION shRNA Lentiviral Transduction Particles pyridoxamine 5'-phosphate oxidase	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000331392
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-343s21c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300812
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-917s21c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300744
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-511s21c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300811
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-673s21c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046029
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-295s1c1
	Sequence:CCGGGCCTGGTTTGAGGAGGCTGTTCTCGAGAACAGCCTCCTCAAACCAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046028
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-241s1c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046031
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-869s1c1
	Sequence:CCGGTCTATGAGAGACTTGCACCTTCTCGAGAAGGTGCAAGTCTCTCATAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046032
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-463s1c1
	Sequence:CCGGGAGCTGGACTCTAATCCCTTTCTCGAGAAAGGGATTAGAGTCCAGCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046030
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018129.1-625s1c1
	Sequence:CCGGCAGAGTTCTGTGATCCCTGATCTCGAGATCAGGGATCACAGAACTCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000300814
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018129.3-289s21c1
	Sequence:CCGGGAGGCATTTGAGGAGACTCATCTCGAGATGAGTCTCCTCAAATGCCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart