EMAIL THIS PAGE TO A FRIEND

PNPT1

polyribonucleotide nucleotidyltransferase 1

68 Gene Product Result for
Synonyms: COXPD13 DFNB70 OLD35 PNPASE old-35
Gene ID:
Human(87178) Summary: The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
Mouse(71701) polyribonucleotide nucleotidyltransferase 1
Rat(360992) polyribonucleotide nucleotidyltransferase 1
Zebrafish(100750260) polynucleotide phosphorylase
chicken(421206) polyribonucleotide nucleotidyltransferase 1
dog(481376) polyribonucleotide nucleotidyltransferase 1
Horse(100052355) polyribonucleotide nucleotidyltransferase 1
domestic cat(101094336) polyribonucleotide nucleotidyltransferase 1
domestic guinea pig(100713826) polyribonucleotide nucleotidyltransferase 1
naked mole-rat(101705889) polyribonucleotide nucleotidyltransferase 1
cow(508877) polyribonucleotide nucleotidyltransferase 1
sheep(101120906) polyribonucleotide nucleotidyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033109 Rosetta Predictions human pricing
XM_001065076 Rosetta Predictions rat pricing
XM_341266 Rosetta Predictions rat pricing
NM_027869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228542 predicted 779
2 SASI_Hs02_00360826 predicted 942
3 SASI_Hs01_00228543 predicted 1772
4 SASI_Hs01_00228545 predicted 1154
5 SASI_Hs01_00228546 predicted 442
6 SASI_Hs01_00228547 predicted 2072
7 SASI_Hs01_00228548 predicted 1267
8 SASI_Hs01_00228549 predicted 1515
9 SASI_Hs01_00228550 predicted 1453
10 SASI_Hs02_00360827 predicted 243
11 SASI_Hs01_00228544 predicted 1235
12 SASI_Hs01_00228551 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312755 predicted 503
2 SASI_Rn02_00312756 predicted 1668
3 SASI_Rn02_00312757 predicted 1921
4 SASI_Rn02_00312758 predicted 231
5 SASI_Rn02_00312759 predicted 1934
6 SASI_Rn02_00312760 predicted 829
7 SASI_Rn02_00312761 predicted 2031
8 SASI_Rn02_00312762 predicted 381
9 SASI_Rn02_00312763 predicted 1579
10 SASI_Rn02_00312764 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392655 predicted 500
2 SASI_Rn02_00392656 predicted 1669
3 SASI_Rn02_00392657 predicted 1913
4 SASI_Rn02_00392658 predicted 236
5 SASI_Rn02_00392659 predicted 1937
6 SASI_Rn02_00392660 predicted 825
7 SASI_Rn02_00392661 predicted 2036
8 SASI_Rn02_00392662 predicted 387
9 SASI_Rn02_00392663 predicted 1582
10 SASI_Rn02_00392664 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186545 predicted 1672
2 SASI_Mm02_00332827 predicted 340
3 SASI_Mm01_00186547 predicted 1085
4 SASI_Mm01_00186548 predicted 901
5 SASI_Mm01_00186549 predicted 1914
6 SASI_Mm01_00186550 predicted 380
7 SASI_Mm01_00186552 predicted 2029
8 SASI_Mm01_00186553 predicted 2229
9 SASI_Mm01_00186554 predicted 873
10 SASI_Mm02_00332828 predicted 844
11 SASI_Mm01_00186546 predicted 1932
12 SASI_Mm01_00186551 predicted 1753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027869
VALIDATED
PNPT1 MISSION shRNA Bacterial Glycerol Stock
polyribonucleotide nucleotidyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-2384s1c1
Sequence:CCGGGCGATATTCTGTGGAGCAAATCTCGAGATTTGCTCCACAGAATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1318s1c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-401s1c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1650s1c1
Sequence:CCGGCCGGTACAAATAAAGGAATAACTCGAGTTATTCCTTTATTTGTACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1649s1c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-2486s21c1
Sequence:CCGGATTTCAGGAGCAACCTATATTCTCGAGAATATAGGTTGCTCCTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-401s21c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1318s21c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1649s21c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027869
VALIDATED
PNPT1 MISSION shRNA shRNA Plasmid DNA
polyribonucleotide nucleotidyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-2384s1c1
Sequence:CCGGGCGATATTCTGTGGAGCAAATCTCGAGATTTGCTCCACAGAATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1318s1c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-401s1c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1650s1c1
Sequence:CCGGCCGGTACAAATAAAGGAATAACTCGAGTTATTCCTTTATTTGTACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1649s1c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-2486s21c1
Sequence:CCGGATTTCAGGAGCAACCTATATTCTCGAGAATATAGGTTGCTCCTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-401s21c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1318s21c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1649s21c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027869
VALIDATED
PNPT1 MISSION shRNA Lentiviral Transduction Particles
polyribonucleotide nucleotidyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-2384s1c1
Sequence:CCGGGCGATATTCTGTGGAGCAAATCTCGAGATTTGCTCCACAGAATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1318s1c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-401s1c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1650s1c1
Sequence:CCGGCCGGTACAAATAAAGGAATAACTCGAGTTATTCCTTTATTTGTACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027869.1-1649s1c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-2486s21c1
Sequence:CCGGATTTCAGGAGCAACCTATATTCTCGAGAATATAGGTTGCTCCTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-401s21c1
Sequence:CCGGCGAGTAATAGATCGTTCAATTCTCGAGAATTGAACGATCTATTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1318s21c1
Sequence:CCGGCGGCAAAGTTACTGGTGTGAACTCGAGTTCACACCAGTAACTTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027869.1-1649s21c1
Sequence:CCGGGCCGGTACAAATAAAGGAATACTCGAGTATTCCTTTATTTGTACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033109
VALIDATED
PNPT1 MISSION shRNA Bacterial Glycerol Stock
polyribonucleotide nucleotidyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033109.2-2827s1c1
Sequence:CCGGGCCTATTTCTTCAGAACTGTTCTCGAGAACAGTTCTGAAGAAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-1979s1c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033109.2-1529s1c1
Sequence:CCGGGCAATAGGATTGGTCACCAAACTCGAGTTTGGTGACCAATCCTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-840s1c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-407s1c1
Sequence:CCGGCGTTCAATTAGACCGCTCTTTCTCGAGAAAGAGCGGTCTAATTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033109.3-2564s21c1
Sequence:CCGGTAATTCGAGTAACCCATATTTCTCGAGAAATATGGGTTACTCGAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-1717s21c1
Sequence:CCGGCTGCATTACAGGCTGATATTACTCGAGTAATATCAGCCTGTAATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033109.3-545s21c1
Sequence:CCGGGCCTGATGTCCTAGCAATTAACTCGAGTTAATTGCTAGGACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-2031s21c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-892s21c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033109
VALIDATED
PNPT1 MISSION shRNA shRNA Plasmid DNA
polyribonucleotide nucleotidyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033109.2-2827s1c1
Sequence:CCGGGCCTATTTCTTCAGAACTGTTCTCGAGAACAGTTCTGAAGAAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-1979s1c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033109.2-1529s1c1
Sequence:CCGGGCAATAGGATTGGTCACCAAACTCGAGTTTGGTGACCAATCCTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-840s1c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-407s1c1
Sequence:CCGGCGTTCAATTAGACCGCTCTTTCTCGAGAAAGAGCGGTCTAATTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033109.3-2564s21c1
Sequence:CCGGTAATTCGAGTAACCCATATTTCTCGAGAAATATGGGTTACTCGAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-1717s21c1
Sequence:CCGGCTGCATTACAGGCTGATATTACTCGAGTAATATCAGCCTGTAATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033109.3-545s21c1
Sequence:CCGGGCCTGATGTCCTAGCAATTAACTCGAGTTAATTGCTAGGACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-2031s21c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-892s21c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033109
VALIDATED
PNPT1 MISSION shRNA Lentiviral Transduction Particles
polyribonucleotide nucleotidyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033109.2-2827s1c1
Sequence:CCGGGCCTATTTCTTCAGAACTGTTCTCGAGAACAGTTCTGAAGAAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-1979s1c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033109.2-1529s1c1
Sequence:CCGGGCAATAGGATTGGTCACCAAACTCGAGTTTGGTGACCAATCCTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-840s1c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_033109.2-407s1c1
Sequence:CCGGCGTTCAATTAGACCGCTCTTTCTCGAGAAAGAGCGGTCTAATTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033109.3-2564s21c1
Sequence:CCGGTAATTCGAGTAACCCATATTTCTCGAGAAATATGGGTTACTCGAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-1717s21c1
Sequence:CCGGCTGCATTACAGGCTGATATTACTCGAGTAATATCAGCCTGTAATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033109.3-545s21c1
Sequence:CCGGGCCTGATGTCCTAGCAATTAACTCGAGTTAATTGCTAGGACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-2031s21c1
Sequence:CCGGGCAAGAGACTTCATTACTGAACTCGAGTTCAGTAATGAAGTCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033109.3-892s21c1
Sequence:CCGGCGCCAGAGATTGTGAAATATACTCGAGTATATTTCACAATCTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)