EMAIL THIS PAGE TO A FRIEND

PNRC1

proline-rich nuclear receptor coactivator 1

111 Gene Product Result for
Synonyms: B4-2 PNAS-145 PROL2 PRR2
UniProtKB ID: Q12796, B2R6Q0, E1P515, Q5T7J6
Gene ID:
Mouse(108767) proline-rich nuclear receptor coactivator 1
Rat(286988) proline-rich nuclear receptor coactivator 1
Zebrafish(100034521) proline-rich nuclear receptor coactivator 1
chicken(421817) proline-rich nuclear receptor coactivator 1
domestic cat(101097397) proline-rich nuclear receptor coactivator 1
cow(507736) proline-rich nuclear receptor coactivator 1
sheep(101114874) proline-rich nuclear receptor coactivator 1
domestic guinea pig(100732278) proline-rich nuclear receptor coactivator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006813 Rosetta Predictions human pricing
NM_173322 Rosetta Predictions rat pricing
NM_001033225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132729 predicted 1180
2 SASI_Hs01_00132730 predicted 1132
3 SASI_Hs01_00132732 predicted 1366
4 SASI_Hs01_00132733 predicted 1294
5 SASI_Hs01_00132734 predicted 898
6 SASI_Hs01_00132737 predicted 1291
7 SASI_Hs01_00132731 predicted 755
8 SASI_Hs01_00132735 predicted 725
9 SASI_Hs01_00132736 predicted 898
10 SASI_Hs02_00342344 predicted 906
11 SASI_Hs01_00132738 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110893 predicted 591
2 SASI_Rn01_00110894 predicted 1035
3 SASI_Rn01_00110895 predicted 1321
4 SASI_Rn01_00110896 predicted 994
5 SASI_Rn01_00110897 predicted 1092
6 SASI_Rn01_00110899 predicted 1362
7 SASI_Rn01_00110900 predicted 1161
8 SASI_Rn01_00110901 predicted 890
9 SASI_Rn01_00110902 predicted 1399
10 SASI_Rn02_00269432 predicted 1148
11 SASI_Rn01_00110898 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044279 predicted 1083
2 SASI_Mm01_00044280 predicted 1659
3 SASI_Mm02_00288350 predicted 914
4 SASI_Mm01_00044281 predicted 638
5 SASI_Mm02_00288351 predicted 1400
6 SASI_Mm02_00288352 predicted 1559
7 SASI_Mm01_00044284 predicted 1688
8 SASI_Mm02_00288353 predicted 1587
9 SASI_Mm01_00044286 predicted 1698
10 SASI_Mm02_00288354 predicted 1469
11 SASI_Mm01_00044282 predicted 810
12 SASI_Mm01_00044283 predicted 1495
13 SASI_Mm01_00044285 predicted 1371
14 SASI_Mm01_00044287 predicted 824
15 SASI_Mm01_00044288 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006813
PNRC1 MISSION shRNA Bacterial Glycerol Stock
proline-rich nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-1123s21c1
Sequence:CCGGAGCTGATGGCAGTACACTTAACTCGAGTTAAGTGTACTGCCATCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-801s21c1
Sequence:CCGGTATGAGCAACCAAAGATAAACCTCGAGGTTTATCTTTGGTTGCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1543s21c1
Sequence:CCGGATCTCAAGGTGAAGATCTAAACTCGAGTTTAGATCTTCACCTTGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1369s21c1
Sequence:CCGGCATACTTGAGAGGTATATTATCTCGAGATAATATACCTCTCAAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-760s1c1
Sequence:CCGGGCAAATATAACTTGCCACTAACTCGAGTTAGTGGCAAGTTATATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-271s1c1
Sequence:CCGGCGACCCTCTTCCTCCCTCATTCTCGAGAATGAGGGAGGAAGAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-707s1c1
Sequence:CCGGGCTTGTTCATGGTATACACTTCTCGAGAAGTGTATACCATGAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-899s1c1
Sequence:CCGGGCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-958s1c1
Sequence:CCGGCAAAGTTTAGTGATCCACCTTCTCGAGAAGGTGGATCACTAAACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006813
PNRC1 MISSION shRNA shRNA Plasmid DNA
proline-rich nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-1123s21c1
Sequence:CCGGAGCTGATGGCAGTACACTTAACTCGAGTTAAGTGTACTGCCATCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-801s21c1
Sequence:CCGGTATGAGCAACCAAAGATAAACCTCGAGGTTTATCTTTGGTTGCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1543s21c1
Sequence:CCGGATCTCAAGGTGAAGATCTAAACTCGAGTTTAGATCTTCACCTTGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1369s21c1
Sequence:CCGGCATACTTGAGAGGTATATTATCTCGAGATAATATACCTCTCAAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-760s1c1
Sequence:CCGGGCAAATATAACTTGCCACTAACTCGAGTTAGTGGCAAGTTATATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-271s1c1
Sequence:CCGGCGACCCTCTTCCTCCCTCATTCTCGAGAATGAGGGAGGAAGAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-707s1c1
Sequence:CCGGGCTTGTTCATGGTATACACTTCTCGAGAAGTGTATACCATGAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-899s1c1
Sequence:CCGGGCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-958s1c1
Sequence:CCGGCAAAGTTTAGTGATCCACCTTCTCGAGAAGGTGGATCACTAAACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006813
PNRC1 MISSION shRNA Lentiviral Transduction Particles
proline-rich nuclear receptor coactivator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-1123s21c1
Sequence:CCGGAGCTGATGGCAGTACACTTAACTCGAGTTAAGTGTACTGCCATCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006813.2-801s21c1
Sequence:CCGGTATGAGCAACCAAAGATAAACCTCGAGGTTTATCTTTGGTTGCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1543s21c1
Sequence:CCGGATCTCAAGGTGAAGATCTAAACTCGAGTTTAGATCTTCACCTTGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006813.2-1369s21c1
Sequence:CCGGCATACTTGAGAGGTATATTATCTCGAGATAATATACCTCTCAAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-760s1c1
Sequence:CCGGGCAAATATAACTTGCCACTAACTCGAGTTAGTGGCAAGTTATATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-271s1c1
Sequence:CCGGCGACCCTCTTCCTCCCTCATTCTCGAGAATGAGGGAGGAAGAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-707s1c1
Sequence:CCGGGCTTGTTCATGGTATACACTTCTCGAGAAGTGTATACCATGAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-899s1c1
Sequence:CCGGGCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006813.1-958s1c1
Sequence:CCGGCAAAGTTTAGTGATCCACCTTCTCGAGAAGGTGGATCACTAAACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033225
PNRC1 MISSION shRNA Bacterial Glycerol Stock
proline-rich nuclear receptor coactivator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1240s21c1
Sequence:CCGGCTGATGGCAGTGCACTTGAAACTCGAGTTTCAAGTGCACTGCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1548s21c1
Sequence:CCGGATACAGTGGAGATAGTCTAAGCTCGAGCTTAGACTATCTCCACTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-890s21c1
Sequence:CCGGGCCAGCTTGTGCATGGTATACCTCGAGGTATACCATGCACAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-948s21c1
Sequence:CCGGCAAATACAACTTGCCACTAACCTCGAGGTTAGTGGCAAGTTGTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1472s21c1
Sequence:CCGGCATACTTGAGAGGACATTATACTCGAGTATAATGTCCTCTCAAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1015s21c1
Sequence:CCGGTCTGCTTCCTCCGATCGAATGCTCGAGCATTCGATCGGAGGAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-915s21c1
Sequence:CCGGGTGTGAACAACCAAAGATAAACTCGAGTTTATCTTTGGTTGTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1086s21c1
Sequence:CCGGCCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1190s21c1
Sequence:CCGGCGAGTCACTGGATGGGAAGTACTCGAGTACTTCCCATCCAGTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1133s21c1
Sequence:CCGGATTACGCCGGAGCAAAGTTCACTCGAGTGAACTTTGCTCCGGCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033225
PNRC1 MISSION shRNA shRNA Plasmid DNA
proline-rich nuclear receptor coactivator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1240s21c1
Sequence:CCGGCTGATGGCAGTGCACTTGAAACTCGAGTTTCAAGTGCACTGCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1548s21c1
Sequence:CCGGATACAGTGGAGATAGTCTAAGCTCGAGCTTAGACTATCTCCACTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-890s21c1
Sequence:CCGGGCCAGCTTGTGCATGGTATACCTCGAGGTATACCATGCACAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-948s21c1
Sequence:CCGGCAAATACAACTTGCCACTAACCTCGAGGTTAGTGGCAAGTTGTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1472s21c1
Sequence:CCGGCATACTTGAGAGGACATTATACTCGAGTATAATGTCCTCTCAAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1015s21c1
Sequence:CCGGTCTGCTTCCTCCGATCGAATGCTCGAGCATTCGATCGGAGGAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-915s21c1
Sequence:CCGGGTGTGAACAACCAAAGATAAACTCGAGTTTATCTTTGGTTGTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1086s21c1
Sequence:CCGGCCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1190s21c1
Sequence:CCGGCGAGTCACTGGATGGGAAGTACTCGAGTACTTCCCATCCAGTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1133s21c1
Sequence:CCGGATTACGCCGGAGCAAAGTTCACTCGAGTGAACTTTGCTCCGGCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033225
PNRC1 MISSION shRNA Lentiviral Transduction Particles
proline-rich nuclear receptor coactivator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1240s21c1
Sequence:CCGGCTGATGGCAGTGCACTTGAAACTCGAGTTTCAAGTGCACTGCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1548s21c1
Sequence:CCGGATACAGTGGAGATAGTCTAAGCTCGAGCTTAGACTATCTCCACTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-890s21c1
Sequence:CCGGGCCAGCTTGTGCATGGTATACCTCGAGGTATACCATGCACAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-948s21c1
Sequence:CCGGCAAATACAACTTGCCACTAACCTCGAGGTTAGTGGCAAGTTGTATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033225.2-1472s21c1
Sequence:CCGGCATACTTGAGAGGACATTATACTCGAGTATAATGTCCTCTCAAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1015s21c1
Sequence:CCGGTCTGCTTCCTCCGATCGAATGCTCGAGCATTCGATCGGAGGAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-915s21c1
Sequence:CCGGGTGTGAACAACCAAAGATAAACTCGAGTTTATCTTTGGTTGTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1086s21c1
Sequence:CCGGCCATTTGAAGAAATCAGCATTCTCGAGAATGCTGATTTCTTCAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1190s21c1
Sequence:CCGGCGAGTCACTGGATGGGAAGTACTCGAGTACTTCCCATCCAGTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033225.2-1133s21c1
Sequence:CCGGATTACGCCGGAGCAAAGTTCACTCGAGTGAACTTTGCTCCGGCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)