EMAIL THIS PAGE TO A FRIEND

POC1B

POC1 centriolar protein B

42 Gene Product Result for
Synonyms: PIX1 TUWD12 WDR51B
UniProtKB ID: Q8TC44, G3V1X0
Gene ID:
Mouse(382406) POC1 centriolar protein homolog B (Chlamydomonas)
Rat(100362836) POC1 centriolar protein homolog B (Chlamydomonas)
naked mole-rat(101696958) POC1 centriolar protein homolog B (Chlamydomonas)
Domestic Rabbit(100355931) POC1 centriolar protein homolog B (Chlamydomonas)
cow(525136) POC1 centriolar protein homolog B (Chlamydomonas)
sheep(101110747) POC1 centriolar protein homolog B (Chlamydomonas)
Zebrafish(386932) POC1 centriolar protein homolog B (Chlamydomonas)
Horse(100063173) POC1 centriolar protein homolog B (Chlamydomonas)
domestic cat(101097657) POC1 centriolar protein homolog B (Chlamydomonas)
dog(475422) POC1 centriolar protein homolog B (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172240 Rosetta Predictions human pricing
NM_027740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203836 predicted 1635
2 SASI_Hs01_00203837 predicted 1009
3 SASI_Hs02_00367953 predicted 634
4 SASI_Hs01_00203838 predicted 1155
5 SASI_Hs01_00203839 predicted 1402
6 SASI_Hs01_00203840 predicted 1383
7 SASI_Hs01_00203841 predicted 786
8 SASI_Hs01_00203842 predicted 1140
9 SASI_Hs02_00367954 predicted 616
10 SASI_Hs01_00203843 predicted 308
11 SASI_Hs01_00203844 predicted 1612
12 SASI_Hs01_00203845 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051549 predicted 510
2 SASI_Mm01_00051550 predicted 1331
3 SASI_Mm01_00051551 predicted 1200
4 SASI_Mm01_00051552 predicted 783
5 SASI_Mm01_00051553 predicted 1186
6 SASI_Mm01_00051554 predicted 554
7 SASI_Mm01_00051555 predicted 201
8 SASI_Mm01_00051556 predicted 1343
9 SASI_Mm01_00051557 predicted 514
10 SASI_Mm01_00051558 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027740
VALIDATED
POC1B MISSION shRNA Bacterial Glycerol Stock
POC1 centriolar protein B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1183s1c1
Sequence:CCGGGCAAGGGTGAAGACATCTGTACTCGAGTACAGATGTCTTCACCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-951s1c1
Sequence:CCGGCTGCACTGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027740.3-1673s1c1
Sequence:CCGGCCCAGGTCTAATTGCAGTAATCTCGAGATTACTGCAATTAGACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027740.3-677s1c1
Sequence:CCGGCTGGGATATAAGAATGAACAACTCGAGTTGTTCATTCTTATATCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1674s1c1
Sequence:CCGGCCAGGTCTAATTGCAGTAATACTCGAGTATTACTGCAATTAGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027740.3-1848s1c1
Sequence:CCGGCCTGAAGGTAATGAATGTGTTCTCGAGAACACATTCATTACCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1334s1c1
Sequence:CCGGGCACATTATGGAACAACTCAACTCGAGTTGAGTTGTTCCATAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1389s1c1
Sequence:CCGGCGACTGTCTTTGACAGAAGATCTCGAGATCTTCTGTCAAAGACAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.6-559s1c1
Sequence:CCGGCCAATAAGCAGTGCGTTAATACTCGAGTATTAACGCACTGCTTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027740
VALIDATED
POC1B MISSION shRNA shRNA Plasmid DNA
POC1 centriolar protein B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1183s1c1
Sequence:CCGGGCAAGGGTGAAGACATCTGTACTCGAGTACAGATGTCTTCACCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-951s1c1
Sequence:CCGGCTGCACTGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027740.3-1673s1c1
Sequence:CCGGCCCAGGTCTAATTGCAGTAATCTCGAGATTACTGCAATTAGACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027740.3-677s1c1
Sequence:CCGGCTGGGATATAAGAATGAACAACTCGAGTTGTTCATTCTTATATCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1674s1c1
Sequence:CCGGCCAGGTCTAATTGCAGTAATACTCGAGTATTACTGCAATTAGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027740.3-1848s1c1
Sequence:CCGGCCTGAAGGTAATGAATGTGTTCTCGAGAACACATTCATTACCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1334s1c1
Sequence:CCGGGCACATTATGGAACAACTCAACTCGAGTTGAGTTGTTCCATAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1389s1c1
Sequence:CCGGCGACTGTCTTTGACAGAAGATCTCGAGATCTTCTGTCAAAGACAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.6-559s1c1
Sequence:CCGGCCAATAAGCAGTGCGTTAATACTCGAGTATTAACGCACTGCTTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027740
VALIDATED
POC1B MISSION shRNA Lentiviral Transduction Particles
POC1 centriolar protein B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1183s1c1
Sequence:CCGGGCAAGGGTGAAGACATCTGTACTCGAGTACAGATGTCTTCACCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-951s1c1
Sequence:CCGGCTGCACTGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACAGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027740.3-1673s1c1
Sequence:CCGGCCCAGGTCTAATTGCAGTAATCTCGAGATTACTGCAATTAGACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027740.3-677s1c1
Sequence:CCGGCTGGGATATAAGAATGAACAACTCGAGTTGTTCATTCTTATATCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1674s1c1
Sequence:CCGGCCAGGTCTAATTGCAGTAATACTCGAGTATTACTGCAATTAGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027740.3-1848s1c1
Sequence:CCGGCCTGAAGGTAATGAATGTGTTCTCGAGAACACATTCATTACCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027740.3-1334s1c1
Sequence:CCGGGCACATTATGGAACAACTCAACTCGAGTTGAGTTGTTCCATAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.3-1389s1c1
Sequence:CCGGCGACTGTCTTTGACAGAAGATCTCGAGATCTTCTGTCAAAGACAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027740.6-559s1c1
Sequence:CCGGCCAATAAGCAGTGCGTTAATACTCGAGTATTAACGCACTGCTTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172240
VALIDATED
POC1B MISSION shRNA Bacterial Glycerol Stock
POC1 centriolar protein B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172240.1-1285s1c1
Sequence:CCGGCCTTCCTTAATGTCACCAGAACTCGAGTTCTGGTGACATTAAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-623s1c1
Sequence:CCGGCCACAAATAAGCAATGTGTTACTCGAGTAACACATTGCTTATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-2046s1c1
Sequence:CCGGGCCTTGAAAGAATGAACAAATCTCGAGATTTGTTCATTCTTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-138s1c1
Sequence:CCGGGCGTTATTTCAAAGGCCACAACTCGAGTTGTGGCCTTTGAAATAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-788s1c1
Sequence:CCGGGCGGTGGAGTTAATTGCATATCTCGAGATATGCAATTAACTCCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-973s21c1
Sequence:CCGGGCAGACACACAGGTCTTATTACTCGAGTAATAAGACCTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-657s21c1
Sequence:CCGGTTCCGTTGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCAACGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172240.1-1702s21c1
Sequence:CCGGGCATACCTAAGGACTAATTTACTCGAGTAAATTAGTCCTTAGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-1122s21c1
Sequence:CCGGAGTTGAGACTGTAGAAATTAACTCGAGTTAATTTCTACAGTCTCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-516s21c1
Sequence:CCGGGTATTCCTTGTATCGACATACCTCGAGGTATGTCGATACAAGGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172240
VALIDATED
POC1B MISSION shRNA shRNA Plasmid DNA
POC1 centriolar protein B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172240.1-1285s1c1
Sequence:CCGGCCTTCCTTAATGTCACCAGAACTCGAGTTCTGGTGACATTAAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-623s1c1
Sequence:CCGGCCACAAATAAGCAATGTGTTACTCGAGTAACACATTGCTTATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-2046s1c1
Sequence:CCGGGCCTTGAAAGAATGAACAAATCTCGAGATTTGTTCATTCTTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-138s1c1
Sequence:CCGGGCGTTATTTCAAAGGCCACAACTCGAGTTGTGGCCTTTGAAATAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-788s1c1
Sequence:CCGGGCGGTGGAGTTAATTGCATATCTCGAGATATGCAATTAACTCCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-973s21c1
Sequence:CCGGGCAGACACACAGGTCTTATTACTCGAGTAATAAGACCTGTGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-657s21c1
Sequence:CCGGTTCCGTTGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCAACGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172240.1-1702s21c1
Sequence:CCGGGCATACCTAAGGACTAATTTACTCGAGTAAATTAGTCCTTAGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-1122s21c1
Sequence:CCGGAGTTGAGACTGTAGAAATTAACTCGAGTTAATTTCTACAGTCTCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-516s21c1
Sequence:CCGGGTATTCCTTGTATCGACATACCTCGAGGTATGTCGATACAAGGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172240
VALIDATED
POC1B MISSION shRNA Lentiviral Transduction Particles
POC1 centriolar protein B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172240.1-1285s1c1
Sequence:CCGGCCTTCCTTAATGTCACCAGAACTCGAGTTCTGGTGACATTAAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-623s1c1
Sequence:CCGGCCACAAATAAGCAATGTGTTACTCGAGTAACACATTGCTTATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-2046s1c1
Sequence:CCGGGCCTTGAAAGAATGAACAAATCTCGAGATTTGTTCATTCTTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-138s1c1
Sequence:CCGGGCGTTATTTCAAAGGCCACAACTCGAGTTGTGGCCTTTGAAATAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172240.1-788s1c1
Sequence:CCGGGCGGTGGAGTTAATTGCATATCTCGAGATATGCAATTAACTCCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-973s21c1
Sequence:CCGGGCAGACACACAGGTCTTATTACTCGAGTAATAAGACCTGTGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-657s21c1
Sequence:CCGGTTCCGTTGGATTTGCAAATTTCTCGAGAAATTTGCAAATCCAACGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172240.1-1702s21c1
Sequence:CCGGGCATACCTAAGGACTAATTTACTCGAGTAAATTAGTCCTTAGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-1122s21c1
Sequence:CCGGAGTTGAGACTGTAGAAATTAACTCGAGTTAATTTCTACAGTCTCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172240.1-516s21c1
Sequence:CCGGGTATTCCTTGTATCGACATACCTCGAGGTATGTCGATACAAGGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)