EMAIL THIS PAGE TO A FRIEND

POC5

POC5 centriolar protein

48 Gene Product Result for
Synonyms: C5orf37
UniProtKB ID: Q8NA72, B4DJG7, Q494X7, Q494X9, Q6P085
Gene ID:
Mouse(67463) POC5 centriolar protein homolog (Chlamydomonas)
Rat(294667) POC5 centriolar protein
Zebrafish(562608) POC5 centriolar protein homolog (Chlamydomonas)
chicken(427210) POC5 centriolar protein homolog (Chlamydomonas)
Horse(100073281) POC5 centriolar protein homolog (Chlamydomonas)
domestic cat(101100107) POC5 centriolar protein homolog (Chlamydomonas)
dog(479179) POC5 centriolar protein homolog (Chlamydomonas)
cow(533555) POC5 centriolar protein homolog (Chlamydomonas)
sheep(101110144) POC5 centriolar protein homolog (Chlamydomonas)
naked mole-rat(101725169) POC5 centriolar protein homolog (Chlamydomonas)
domestic guinea pig(100725782) POC5 centriolar protein homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152408 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009981 MISSION® esiRNA targeting human POC5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099271 Rosetta Predictions human pricing
NM_152408 Rosetta Predictions human pricing
NM_001025647 Rosetta Predictions rat pricing
NM_026173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320307 predicted 1131
2 SASI_Hs02_00320308 predicted 603
3 SASI_Hs02_00320309 predicted 933
4 SASI_Hs02_00320310 predicted 693
5 SASI_Hs02_00320311 predicted 1092
6 SASI_Hs02_00320312 predicted 1162
7 SASI_Hs02_00320313 predicted 620
8 SASI_Hs02_00320314 predicted 1103
9 SASI_Hs02_00320315 predicted 1325
10 SASI_Hs02_00320316 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160153 predicted 924
2 SASI_Hs01_00160154 predicted 403
3 SASI_Hs01_00160155 predicted 726
4 SASI_Hs01_00160156 predicted 499
5 SASI_Hs01_00160157 predicted 890
6 SASI_Hs01_00160158 predicted 968
7 SASI_Hs01_00160159 predicted 418
8 SASI_Hs01_00160160 predicted 902
9 SASI_Hs01_00160161 predicted 1118
10 SASI_Hs02_00366098 predicted 1113
11 SASI_Hs01_00160152 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041700 predicted 397
2 SASI_Rn01_00041701 predicted 1454
3 SASI_Rn01_00041702 predicted 574
4 SASI_Rn01_00041703 predicted 478
5 SASI_Rn01_00041704 predicted 419
6 SASI_Rn01_00041705 predicted 980
7 SASI_Rn01_00041706 predicted 728
8 SASI_Rn01_00041707 predicted 857
9 SASI_Rn01_00041708 predicted 1329
10 SASI_Rn01_00041709 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071423 predicted 1056
2 SASI_Mm01_00071424 predicted 1239
3 SASI_Mm01_00071425 predicted 1396
4 SASI_Mm01_00071427 predicted 510
5 SASI_Mm01_00071428 predicted 2013
6 SASI_Mm02_00329813 predicted 1725
7 SASI_Mm01_00071429 predicted 410
8 SASI_Mm01_00071430 predicted 355
9 SASI_Mm01_00071431 predicted 795
10 SASI_Mm01_00071432 predicted 937
11 SASI_Mm01_00071426 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152408
VALIDATED
POC5 MISSION shRNA Bacterial Glycerol Stock
POC5 centriolar protein
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-263s21c1
Sequence:CCGGAGGATGTGATTTCCATATTTCCTCGAGGAAATATGGAAATCACATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-932s21c1
Sequence:CCGGTATCCAGATTTCCAATGATTACTCGAGTAATCATTGGAAATCTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-750s1c1
Sequence:CCGGGCCAGACAGGATGTTTATGAACTCGAGTTCATAAACATCCTGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-270s1c1
Sequence:CCGGGATGAGTCATCACCAGTGTTACTCGAGTAACACTGGTGATGACTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-390s1c1
Sequence:CCGGCATGAAATACTTGTGAGCGATCTCGAGATCGCTCACAAGTATTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1725s21c1
Sequence:CCGGAGTGAATATGTCCATAGTGGGCTCGAGCCCACTATGGACATATTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1214s21c1
Sequence:CCGGTCCGATGCCCTTACCAGTTACCTCGAGGTAACTGGTAAGGGCATCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-848s1c1
Sequence:CCGGGCAGTGGAAAGATGTGGTAGACTCGAGTCTACCACATCTTTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-360s1c1
Sequence:CCGGCCAGCAACAAATTCTAGTCATCTCGAGATGACTAGAATTTGTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1502s21c1
Sequence:CCGGTAGCAGCAGTTTAGCTATAATCTCGAGATTATAGCTAAACTGCTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1799s21c1
Sequence:CCGGTTTCCATATTGTTAGAACATCCTCGAGGATGTTCTAACAATATGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-794s1c1
Sequence:CCGGCCAGAGAACTTTACTGAAGAACTCGAGTTCTTCAGTAAAGTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-1302s1c1
Sequence:CCGGGCATCTTCTGTTCACGTTCCTCTCGAGAGGAACGTGAACAGAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-969s1c1
Sequence:CCGGGCTGAGATTCAAAGAATGCAACTCGAGTTGCATTCTTTGAATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1396s1c1
Sequence:CCGGCTGCACAACAGAAAGCAGGAACTCGAGTTCCTGCTTTCTGTTGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1356s1c1
Sequence:CCGGGCTGCATCAGAAGAAATGTATCTCGAGATACATTTCTTCTGATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-199s1c1
Sequence:CCGGCTGAAGTAAGAGAAACTGCAACTCGAGTTGCAGTTTCTCTTACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152408
VALIDATED
POC5 MISSION shRNA shRNA Plasmid DNA
POC5 centriolar protein
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-263s21c1
Sequence:CCGGAGGATGTGATTTCCATATTTCCTCGAGGAAATATGGAAATCACATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-932s21c1
Sequence:CCGGTATCCAGATTTCCAATGATTACTCGAGTAATCATTGGAAATCTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-750s1c1
Sequence:CCGGGCCAGACAGGATGTTTATGAACTCGAGTTCATAAACATCCTGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-270s1c1
Sequence:CCGGGATGAGTCATCACCAGTGTTACTCGAGTAACACTGGTGATGACTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-390s1c1
Sequence:CCGGCATGAAATACTTGTGAGCGATCTCGAGATCGCTCACAAGTATTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1725s21c1
Sequence:CCGGAGTGAATATGTCCATAGTGGGCTCGAGCCCACTATGGACATATTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1214s21c1
Sequence:CCGGTCCGATGCCCTTACCAGTTACCTCGAGGTAACTGGTAAGGGCATCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-848s1c1
Sequence:CCGGGCAGTGGAAAGATGTGGTAGACTCGAGTCTACCACATCTTTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-360s1c1
Sequence:CCGGCCAGCAACAAATTCTAGTCATCTCGAGATGACTAGAATTTGTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1502s21c1
Sequence:CCGGTAGCAGCAGTTTAGCTATAATCTCGAGATTATAGCTAAACTGCTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1799s21c1
Sequence:CCGGTTTCCATATTGTTAGAACATCCTCGAGGATGTTCTAACAATATGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-794s1c1
Sequence:CCGGCCAGAGAACTTTACTGAAGAACTCGAGTTCTTCAGTAAAGTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-1302s1c1
Sequence:CCGGGCATCTTCTGTTCACGTTCCTCTCGAGAGGAACGTGAACAGAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-969s1c1
Sequence:CCGGGCTGAGATTCAAAGAATGCAACTCGAGTTGCATTCTTTGAATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1396s1c1
Sequence:CCGGCTGCACAACAGAAAGCAGGAACTCGAGTTCCTGCTTTCTGTTGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1356s1c1
Sequence:CCGGGCTGCATCAGAAGAAATGTATCTCGAGATACATTTCTTCTGATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-199s1c1
Sequence:CCGGCTGAAGTAAGAGAAACTGCAACTCGAGTTGCAGTTTCTCTTACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152408
VALIDATED
POC5 MISSION shRNA Lentiviral Transduction Particles
POC5 centriolar protein
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-263s21c1
Sequence:CCGGAGGATGTGATTTCCATATTTCCTCGAGGAAATATGGAAATCACATCCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-932s21c1
Sequence:CCGGTATCCAGATTTCCAATGATTACTCGAGTAATCATTGGAAATCTGGATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-750s1c1
Sequence:CCGGGCCAGACAGGATGTTTATGAACTCGAGTTCATAAACATCCTGTCTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-270s1c1
Sequence:CCGGGATGAGTCATCACCAGTGTTACTCGAGTAACACTGGTGATGACTCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-390s1c1
Sequence:CCGGCATGAAATACTTGTGAGCGATCTCGAGATCGCTCACAAGTATTTCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1725s21c1
Sequence:CCGGAGTGAATATGTCCATAGTGGGCTCGAGCCCACTATGGACATATTCACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1214s21c1
Sequence:CCGGTCCGATGCCCTTACCAGTTACCTCGAGGTAACTGGTAAGGGCATCGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-848s1c1
Sequence:CCGGGCAGTGGAAAGATGTGGTAGACTCGAGTCTACCACATCTTTCCACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-360s1c1
Sequence:CCGGCCAGCAACAAATTCTAGTCATCTCGAGATGACTAGAATTTGTTGCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152408.2-1502s21c1
Sequence:CCGGTAGCAGCAGTTTAGCTATAATCTCGAGATTATAGCTAAACTGCTGCTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152408.2-1799s21c1
Sequence:CCGGTTTCCATATTGTTAGAACATCCTCGAGGATGTTCTAACAATATGGAAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-794s1c1
Sequence:CCGGCCAGAGAACTTTACTGAAGAACTCGAGTTCTTCAGTAAAGTTCTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000140815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-1302s1c1
Sequence:CCGGGCATCTTCTGTTCACGTTCCTCTCGAGAGGAACGTGAACAGAAGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152408.1-969s1c1
Sequence:CCGGGCTGAGATTCAAAGAATGCAACTCGAGTTGCATTCTTTGAATCTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1396s1c1
Sequence:CCGGCTGCACAACAGAAAGCAGGAACTCGAGTTCCTGCTTTCTGTTGTGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-1356s1c1
Sequence:CCGGGCTGCATCAGAAGAAATGTATCTCGAGATACATTTCTTCTGATGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152408.1-199s1c1
Sequence:CCGGCTGAAGTAAGAGAAACTGCAACTCGAGTTGCAGTTTCTCTTACTTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026173
POC5 MISSION shRNA Bacterial Glycerol Stock
POC5 centriolar protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1774s21c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1396s21c1
Sequence:CCGGAGGGATAGACTTCACAAATAACTCGAGTTATTTGTGAAGTCTATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1358s21c1
Sequence:CCGGCTGGAGGCCATGACCATATTTCTCGAGAAATATGGTCATGGCCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1960s21c1
Sequence:CCGGTCTCTCAGTTCAGTCGATAAACTCGAGTTTATCGACTGAACTGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1717s1c1
Sequence:CCGGGAAGACAATTACAGCCCGGATCTCGAGATCCGGGCTGTAATTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026173.2-2264s1c1
Sequence:CCGGGCCATTGTGGAAGAATATAAACTCGAGTTTATATTCTTCCACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026173.2-2323s21c1
Sequence:CCGGATTGTTGCTGGGCAGTAATTTCTCGAGAAATTACTGCCCAGCAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1394s1c1
Sequence:CCGGGCAGGGATAGACTTCACAAATCTCGAGATTTGTGAAGTCTATCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-461s1c1
Sequence:CCGGCCATCTCACCTTAGAGGAGAACTCGAGTTCTCCTCTAAGGTGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1774s1c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026173
POC5 MISSION shRNA shRNA Plasmid DNA
POC5 centriolar protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1774s21c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1396s21c1
Sequence:CCGGAGGGATAGACTTCACAAATAACTCGAGTTATTTGTGAAGTCTATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1358s21c1
Sequence:CCGGCTGGAGGCCATGACCATATTTCTCGAGAAATATGGTCATGGCCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1960s21c1
Sequence:CCGGTCTCTCAGTTCAGTCGATAAACTCGAGTTTATCGACTGAACTGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1717s1c1
Sequence:CCGGGAAGACAATTACAGCCCGGATCTCGAGATCCGGGCTGTAATTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026173.2-2264s1c1
Sequence:CCGGGCCATTGTGGAAGAATATAAACTCGAGTTTATATTCTTCCACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026173.2-2323s21c1
Sequence:CCGGATTGTTGCTGGGCAGTAATTTCTCGAGAAATTACTGCCCAGCAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1394s1c1
Sequence:CCGGGCAGGGATAGACTTCACAAATCTCGAGATTTGTGAAGTCTATCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-461s1c1
Sequence:CCGGCCATCTCACCTTAGAGGAGAACTCGAGTTCTCCTCTAAGGTGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1774s1c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026173
POC5 MISSION shRNA Lentiviral Transduction Particles
POC5 centriolar protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1774s21c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1396s21c1
Sequence:CCGGAGGGATAGACTTCACAAATAACTCGAGTTATTTGTGAAGTCTATCCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1358s21c1
Sequence:CCGGCTGGAGGCCATGACCATATTTCTCGAGAAATATGGTCATGGCCTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026173.2-1960s21c1
Sequence:CCGGTCTCTCAGTTCAGTCGATAAACTCGAGTTTATCGACTGAACTGAGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1717s1c1
Sequence:CCGGGAAGACAATTACAGCCCGGATCTCGAGATCCGGGCTGTAATTGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026173.2-2264s1c1
Sequence:CCGGGCCATTGTGGAAGAATATAAACTCGAGTTTATATTCTTCCACAATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026173.2-2323s21c1
Sequence:CCGGATTGTTGCTGGGCAGTAATTTCTCGAGAAATTACTGCCCAGCAACAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1394s1c1
Sequence:CCGGGCAGGGATAGACTTCACAAATCTCGAGATTTGTGAAGTCTATCCCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-461s1c1
Sequence:CCGGCCATCTCACCTTAGAGGAGAACTCGAGTTCTCCTCTAAGGTGAGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026173.2-1774s1c1
Sequence:CCGGCAACAGCAGTTTGGCGATAATCTCGAGATTATCGCCAAACTGCTGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???