EMAIL THIS PAGE TO A FRIEND

PODNL1

podocan-like 1

58 Gene Product Result for
Synonyms: SLRR5B
UniProtKB ID: Q6PEZ8, B7Z564, Q9H5G9
Gene ID:
Mouse(244550) podocan-like 1
Rat(288907) podocan-like 1
cow(534549) podocan-like 1
sheep(101119638) podocan-like 1
naked mole-rat(101701863) podocan-like 1
dog(484910) podocan-like 1
domestic cat(101095799) podocan-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU167981 MISSION® esiRNA esiRNA targeting mouse Podnl1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024825 Rosetta Predictions human pricing
XM_001068151 Rosetta Predictions rat pricing
XM_213845 Rosetta Predictions rat pricing
NM_001013384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040617 predicted 1427
2 SASI_Hs01_00040618 predicted 717
3 SASI_Hs01_00040620 predicted 729
4 SASI_Hs01_00040621 predicted 270
5 SASI_Hs01_00040622 predicted 466
6 SASI_Hs01_00040623 predicted 786
7 SASI_Hs01_00040625 predicted 459
8 SASI_Hs01_00040626 predicted 447
9 SASI_Hs02_00357387 predicted 467
10 SASI_Hs02_00357388 predicted 273
11 SASI_Hs01_00040619 predicted 574
12 SASI_Hs01_00040624 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323616 predicted 847
2 SASI_Rn02_00323617 predicted 632
3 SASI_Rn02_00323618 predicted 697
4 SASI_Rn02_00323619 predicted 1884
5 SASI_Rn02_00323620 predicted 1945
6 SASI_Rn02_00323621 predicted 1016
7 SASI_Rn02_00323622 predicted 863
8 SASI_Rn02_00323623 predicted 1495
9 SASI_Rn02_00323624 predicted 714
10 SASI_Rn02_00323625 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374966 predicted 575
2 SASI_Rn02_00374967 predicted 631
3 SASI_Rn02_00374968 predicted 564
4 SASI_Rn02_00374969 predicted 700
5 SASI_Rn02_00374970 predicted 481
6 SASI_Rn02_00374971 predicted 348
7 SASI_Rn02_00374972 predicted 307
8 SASI_Rn02_00374973 predicted 724
9 SASI_Rn02_00374974 predicted 506
10 SASI_Rn02_00374975 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287211 predicted 971
2 SASI_Mm01_00150394 predicted 839
3 SASI_Mm01_00150397 predicted 684
4 SASI_Mm02_00287212 predicted 658
5 SASI_Mm01_00150398 predicted 270
6 SASI_Mm02_00287213 predicted 540
7 SASI_Mm01_00150399 predicted 1399
8 SASI_Mm01_00150401 predicted 284
9 SASI_Mm02_00287214 predicted 681
10 SASI_Mm02_00287215 predicted 810
11 SASI_Mm01_00150395 predicted 672
12 SASI_Mm01_00150396 predicted 970
13 SASI_Mm01_00150400 predicted 1852
14 SASI_Mm01_00150402 predicted 483
15 SASI_Mm01_00150403 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024825
PODNL1 MISSION shRNA Bacterial Glycerol Stock
podocan-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1063s21c1
Sequence:CCGGCAAGCTGCATAGCCTTGAATACTCGAGTATTCAAGGCTATGCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1959s1c1
Sequence:CCGGCACAGCAAGACCCTATCTCTACTCGAGTAGAGATAGGGTCTTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1786s21c1
Sequence:CCGGCGTCCCAAACATTCTAGTTAGCTCGAGCTAACTAGAATGTTTGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-468s21c1
Sequence:CCGGTTCGAGTGTTCCCGGACAACACTCGAGTGTTGTCCGGGAACACTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024825.2-1923s21c1
Sequence:CCGGTCGCTTTAGGCTATGGGTTTGCTCGAGCAAACCCATAGCCTAAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1430s21c1
Sequence:CCGGGAGCTTAACCTGGCCTATAACCTCGAGGTTATAGGCCAGGTTAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1915s1c1
Sequence:CCGGCAGGAGAATCGCTTTAGGCTACTCGAGTAGCCTAAAGCGATTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024825.2-1069s1c1
Sequence:CCGGGCATAGCCTTGAATACCTGGACTCGAGTCCAGGTATTCAAGGCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024825
PODNL1 MISSION shRNA shRNA Plasmid DNA
podocan-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1063s21c1
Sequence:CCGGCAAGCTGCATAGCCTTGAATACTCGAGTATTCAAGGCTATGCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1959s1c1
Sequence:CCGGCACAGCAAGACCCTATCTCTACTCGAGTAGAGATAGGGTCTTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1786s21c1
Sequence:CCGGCGTCCCAAACATTCTAGTTAGCTCGAGCTAACTAGAATGTTTGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-468s21c1
Sequence:CCGGTTCGAGTGTTCCCGGACAACACTCGAGTGTTGTCCGGGAACACTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024825.2-1923s21c1
Sequence:CCGGTCGCTTTAGGCTATGGGTTTGCTCGAGCAAACCCATAGCCTAAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1430s21c1
Sequence:CCGGGAGCTTAACCTGGCCTATAACCTCGAGGTTATAGGCCAGGTTAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1915s1c1
Sequence:CCGGCAGGAGAATCGCTTTAGGCTACTCGAGTAGCCTAAAGCGATTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024825.2-1069s1c1
Sequence:CCGGGCATAGCCTTGAATACCTGGACTCGAGTCCAGGTATTCAAGGCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024825
PODNL1 MISSION shRNA Lentiviral Transduction Particles
podocan-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1063s21c1
Sequence:CCGGCAAGCTGCATAGCCTTGAATACTCGAGTATTCAAGGCTATGCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172762    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1959s1c1
Sequence:CCGGCACAGCAAGACCCTATCTCTACTCGAGTAGAGATAGGGTCTTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1786s21c1
Sequence:CCGGCGTCCCAAACATTCTAGTTAGCTCGAGCTAACTAGAATGTTTGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-468s21c1
Sequence:CCGGTTCGAGTGTTCCCGGACAACACTCGAGTGTTGTCCGGGAACACTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024825.2-1923s21c1
Sequence:CCGGTCGCTTTAGGCTATGGGTTTGCTCGAGCAAACCCATAGCCTAAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024825.2-1430s21c1
Sequence:CCGGGAGCTTAACCTGGCCTATAACCTCGAGGTTATAGGCCAGGTTAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024825.2-1915s1c1
Sequence:CCGGCAGGAGAATCGCTTTAGGCTACTCGAGTAGCCTAAAGCGATTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024825.2-1069s1c1
Sequence:CCGGGCATAGCCTTGAATACCTGGACTCGAGTCCAGGTATTCAAGGCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013384
PODNL1 MISSION shRNA Bacterial Glycerol Stock
podocan-like 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-617s1c1
Sequence:CCGGCCACAACAACAGACTGAGGAACTCGAGTTCCTCAGTCTGTTGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1547s1c1
Sequence:CCGGGAGCCACAATGAGCTATCTTTCTCGAGAAAGATAGCTCATTGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-294s1c1
Sequence:CCGGCCAGACAATATCACCAGAGCTCTCGAGAGCTCTGGTGATATTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.2-671s1c1
Sequence:CCGGGGAGGTTATTACCACCTTAAGCTCGAGCTTAAGGTGGTAATAACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1691s1c1
Sequence:CCGGCAGGCTTCATATGACCAGCATCTCGAGATGCTGGTCATATGAAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1682s1c1
Sequence:CCGGCAGGGCTAACAGGCTTCATATCTCGAGATATGAAGCCTGTTAGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013384
PODNL1 MISSION shRNA shRNA Plasmid DNA
podocan-like 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-617s1c1
Sequence:CCGGCCACAACAACAGACTGAGGAACTCGAGTTCCTCAGTCTGTTGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1547s1c1
Sequence:CCGGGAGCCACAATGAGCTATCTTTCTCGAGAAAGATAGCTCATTGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-294s1c1
Sequence:CCGGCCAGACAATATCACCAGAGCTCTCGAGAGCTCTGGTGATATTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.2-671s1c1
Sequence:CCGGGGAGGTTATTACCACCTTAAGCTCGAGCTTAAGGTGGTAATAACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1691s1c1
Sequence:CCGGCAGGCTTCATATGACCAGCATCTCGAGATGCTGGTCATATGAAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1682s1c1
Sequence:CCGGCAGGGCTAACAGGCTTCATATCTCGAGATATGAAGCCTGTTAGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013384
PODNL1 MISSION shRNA Lentiviral Transduction Particles
podocan-like 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-617s1c1
Sequence:CCGGCCACAACAACAGACTGAGGAACTCGAGTTCCTCAGTCTGTTGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1547s1c1
Sequence:CCGGGAGCCACAATGAGCTATCTTTCTCGAGAAAGATAGCTCATTGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-294s1c1
Sequence:CCGGCCAGACAATATCACCAGAGCTCTCGAGAGCTCTGGTGATATTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.2-671s1c1
Sequence:CCGGGGAGGTTATTACCACCTTAAGCTCGAGCTTAAGGTGGTAATAACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1691s1c1
Sequence:CCGGCAGGCTTCATATGACCAGCATCTCGAGATGCTGGTCATATGAAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013384.1-1682s1c1
Sequence:CCGGCAGGGCTAACAGGCTTCATATCTCGAGATATGAAGCCTGTTAGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)