EMAIL THIS PAGE TO A FRIEND

PODXL2

podocalyxin-like 2

43 Gene Product Result for
Synonyms: EG PODLX2
UniProtKB ID: Q9NZ53, Q6UVY4, Q8WUV6
Gene ID:
Human(50512) Summary: This gene is a member of the CD34 family of cell surface transmembrane proteins, which are characterized by an N-terminal extracellular mucin domain, globular and stalk domains, a single pass transmembrane region, and a charged cytoplasmic tail. The encoded protein is a ligand for vascular selectins. [provided by RefSeq, Oct 2012]
Mouse(319655) podocalyxin-like 2
Rat(297433) podocalyxin-like 2
cow(532521) podocalyxin-like 2
sheep(101115832) podocalyxin-like 2
naked mole-rat(101706059) podocalyxin-like 2
domestic guinea pig(100719918) podocalyxin-like 2
Zebrafish(563754) podocalyxin-like 2
chicken(770690) podocalyxin-like 2
domestic cat(101092342) podocalyxin-like 2
dog(484623) podocalyxin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146331 MISSION® esiRNA esiRNA human PODXL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015720 Rosetta Predictions human pricing
NM_001106607 Rosetta Predictions rat pricing
NM_176973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150098 predicted 849
2 SASI_Hs01_00150099 predicted 1132
3 SASI_Hs01_00150101 predicted 1390
4 SASI_Hs01_00150102 predicted 1450
5 SASI_Hs01_00150103 predicted 996
6 SASI_Hs01_00150104 predicted 1143
7 SASI_Hs01_00150105 predicted 1162
8 SASI_Hs01_00150106 predicted 899
9 SASI_Hs01_00150107 predicted 1147
10 SASI_Hs02_00348407 predicted 1502
11 SASI_Hs01_00150100 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220618 predicted 1112
2 SASI_Rn02_00220619 predicted 1389
3 SASI_Rn02_00220620 predicted 199
4 SASI_Rn02_00220621 predicted 1129
5 SASI_Rn02_00220622 predicted 1619
6 SASI_Rn02_00220623 predicted 1203
7 SASI_Rn02_00220624 predicted 1634
8 SASI_Rn02_00220625 predicted 1723
9 SASI_Rn02_00220626 predicted 1094
10 SASI_Rn02_00220627 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045978 predicted 1082
2 SASI_Mm01_00045980 predicted 1097
3 SASI_Mm01_00045982 predicted 1693
4 SASI_Mm02_00346887 predicted 1152
5 SASI_Mm02_00346888 predicted 1161
6 SASI_Mm01_00045984 predicted 1749
7 SASI_Mm02_00346889 predicted 887
8 SASI_Mm02_00346890 predicted 1146
9 SASI_Mm02_00346891 predicted 1761
10 SASI_Mm02_00346892 predicted 1119
11 SASI_Mm01_00045977 predicted 1480
12 SASI_Mm01_00045979 predicted 1278
13 SASI_Mm01_00045981 predicted 1608
14 SASI_Mm01_00045983 predicted 1160
15 SASI_Mm01_00045985 predicted 1158
16 SASI_Mm01_00045986 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015720
PODXL2 MISSION shRNA Bacterial Glycerol Stock
podocalyxin-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-360s21c1
Sequence:CCGGGGGACCCACTGCAGATTATGTCTCGAGACATAATCTGCAGTGGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1036s1c1
Sequence:CCGGGAGACATGGAACTGACACCTTCTCGAGAAGGTGTCAGTTCCATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1553s21c1
Sequence:CCGGCCATCTGCATCATCATCATTGCTCGAGCAATGATGATGATGCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-939s21c1
Sequence:CCGGCTTGCCTTCATTCCCTCAAACCTCGAGGTTTGAGGGAATGAAGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1205s21c1
Sequence:CCGGTGAACATGACAGAGAACATAGCTCGAGCTATGTTCTCTGTCATGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1448s21c1
Sequence:CCGGAGATTGGCATCCAGAACTATTCTCGAGAATAGTTCTGGATGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1113s1c1
Sequence:CCGGGCTGAAGCTCAATCCAGGATACTCGAGTATCCTGGATTGAGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015720
PODXL2 MISSION shRNA shRNA Plasmid DNA
podocalyxin-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-360s21c1
Sequence:CCGGGGGACCCACTGCAGATTATGTCTCGAGACATAATCTGCAGTGGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1036s1c1
Sequence:CCGGGAGACATGGAACTGACACCTTCTCGAGAAGGTGTCAGTTCCATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1553s21c1
Sequence:CCGGCCATCTGCATCATCATCATTGCTCGAGCAATGATGATGATGCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-939s21c1
Sequence:CCGGCTTGCCTTCATTCCCTCAAACCTCGAGGTTTGAGGGAATGAAGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1205s21c1
Sequence:CCGGTGAACATGACAGAGAACATAGCTCGAGCTATGTTCTCTGTCATGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1448s21c1
Sequence:CCGGAGATTGGCATCCAGAACTATTCTCGAGAATAGTTCTGGATGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1113s1c1
Sequence:CCGGGCTGAAGCTCAATCCAGGATACTCGAGTATCCTGGATTGAGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015720
PODXL2 MISSION shRNA Lentiviral Transduction Particles
podocalyxin-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-360s21c1
Sequence:CCGGGGGACCCACTGCAGATTATGTCTCGAGACATAATCTGCAGTGGGTCCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000172549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1036s1c1
Sequence:CCGGGAGACATGGAACTGACACCTTCTCGAGAAGGTGTCAGTTCCATGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1553s21c1
Sequence:CCGGCCATCTGCATCATCATCATTGCTCGAGCAATGATGATGATGCAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-939s21c1
Sequence:CCGGCTTGCCTTCATTCCCTCAAACCTCGAGGTTTGAGGGAATGAAGGCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1205s21c1
Sequence:CCGGTGAACATGACAGAGAACATAGCTCGAGCTATGTTCTCTGTCATGTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015720.2-1448s21c1
Sequence:CCGGAGATTGGCATCCAGAACTATTCTCGAGAATAGTTCTGGATGCCAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000172575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015720.1-1113s1c1
Sequence:CCGGGCTGAAGCTCAATCCAGGATACTCGAGTATCCTGGATTGAGCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176973
PODXL2 MISSION shRNA Bacterial Glycerol Stock
podocalyxin-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1170s1c1
Sequence:CCGGGAACATAGACTGTGAAGTATTCTCGAGAATACTTCACAGTCTATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1168s1c1
Sequence:CCGGCAGAACATAGACTGTGAAGTACTCGAGTACTTCACAGTCTATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1269s1c1
Sequence:CCGGCTGGCATATTTCTCTGAGCAACTCGAGTTGCTCAGAGAAATATGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1140s1c1
Sequence:CCGGGAAGAGCTACATCATCCTGAACTCGAGTTCAGGATGATGTAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1152s1c1
Sequence:CCGGCATCCTGAACATGACACAGAACTCGAGTTCTGTGTCATGTTCAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1069s1c1
Sequence:CCGGGCTGAAGCTCACTCACTAACACTCGAGTGTTAGTGAGTGAGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1476s1c1
Sequence:CCGGGCTCTTTGTAGTGCTGGTGATCTCGAGATCACCAGCACTACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176973
PODXL2 MISSION shRNA shRNA Plasmid DNA
podocalyxin-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1170s1c1
Sequence:CCGGGAACATAGACTGTGAAGTATTCTCGAGAATACTTCACAGTCTATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1168s1c1
Sequence:CCGGCAGAACATAGACTGTGAAGTACTCGAGTACTTCACAGTCTATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1269s1c1
Sequence:CCGGCTGGCATATTTCTCTGAGCAACTCGAGTTGCTCAGAGAAATATGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1140s1c1
Sequence:CCGGGAAGAGCTACATCATCCTGAACTCGAGTTCAGGATGATGTAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1152s1c1
Sequence:CCGGCATCCTGAACATGACACAGAACTCGAGTTCTGTGTCATGTTCAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1069s1c1
Sequence:CCGGGCTGAAGCTCACTCACTAACACTCGAGTGTTAGTGAGTGAGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1476s1c1
Sequence:CCGGGCTCTTTGTAGTGCTGGTGATCTCGAGATCACCAGCACTACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176973
PODXL2 MISSION shRNA Lentiviral Transduction Particles
podocalyxin-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1170s1c1
Sequence:CCGGGAACATAGACTGTGAAGTATTCTCGAGAATACTTCACAGTCTATGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1168s1c1
Sequence:CCGGCAGAACATAGACTGTGAAGTACTCGAGTACTTCACAGTCTATGTTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1269s1c1
Sequence:CCGGCTGGCATATTTCTCTGAGCAACTCGAGTTGCTCAGAGAAATATGCCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1140s1c1
Sequence:CCGGGAAGAGCTACATCATCCTGAACTCGAGTTCAGGATGATGTAGCTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1152s1c1
Sequence:CCGGCATCCTGAACATGACACAGAACTCGAGTTCTGTGTCATGTTCAGGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1069s1c1
Sequence:CCGGGCTGAAGCTCACTCACTAACACTCGAGTGTTAGTGAGTGAGCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176973.3-1476s1c1
Sequence:CCGGGCTCTTTGTAGTGCTGGTGATCTCGAGATCACCAGCACTACAAAGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???