EMAIL THIS PAGE TO A FRIEND

POLA1

polymerase (DNA directed), alpha 1, catalytic subunit

92 Gene Product Result for
Synonyms: POLA p180
UniProtKB ID: P09884, Q86UQ7
Gene ID:
Human(5422) Summary: This gene encodes the catalytic subunit of DNA polymerase, which together with a regulatory and two primase subunits, forms the DNA polymerase alpha complex. The catalytic subunit plays an essential role in the initiation of DNA replication. [provided by RefSeq, Mar 2010]
Mouse(18968) polymerase (DNA directed), alpha 1
Rat(85241) polymerase (DNA directed), alpha 1, catalytic subunit
cow(534848) polymerase (DNA directed), alpha 1, catalytic subunit
sheep(101115602) polymerase (DNA directed), alpha 1, catalytic subunit
domestic guinea pig(100717633) polymerase (DNA directed), alpha 1, catalytic subunit
Domestic Rabbit(100354472) polymerase (DNA directed), alpha 1, catalytic subunit
naked mole-rat(101701641) polymerase (DNA directed), alpha 1, catalytic subunit
Zebrafish(317740) polymerase (DNA directed), alpha 1
dog(480869) polymerase (DNA directed), alpha 1, catalytic subunit
Horse(100052225) polymerase (DNA directed), alpha 1, catalytic subunit
domestic cat(101098929) polymerase (DNA directed), alpha 1, catalytic subunit
chicken(418593) polymerase (DNA directed), alpha 1, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A0781 Aphidicolin from Nigrospora sphaerica ≥98% (HPLC), powder human pricing
D6128 5α-Cholestan-3β-ol ≥95% human, rat pricing
47129 Cholestanol solution certified reference material, 10 mg/mL in chloroform human, rat pricing
C8667 Cholesterol Sigma Grade, ≥99% human, rat pricing
C8503 Cholesterol from sheep wool, ≥92.5% (GC), powder human, rat pricing
C3045 Cholesterol powder, BioReagent, suitable for cell culture, ≥99% human, rat pricing
C3292 Cholesterol ≥95% (GC), powder, Ash, free human, rat pricing
26732 Cholesterol from lanolin, ≥99.0% (GC) human, rat pricing
26740 Cholesterol from lanolin, ≥95.0% (GC) human, rat pricing
14606 Cholesterol tested according to Ph.Eur. human, rat pricing
47127-U Cholesterol solution certified reference material, 10 mg/mL in chloroform human, rat pricing
C1231 Cholesterol, Plant-Derived SyntheChol®, PharmaGrade, USP/NF, Ph Eur, Manufactured under appropriate GMP controls for pharma or biopharmaceutical production human, rat pricing
L6250 Lithocholic acid ≥95% human, rat pricing
P6801 Sodium phosphonoformate tribasic hexahydrate human, rat pricing
S2424 Stigmasterol ~95% human, rat pricing
47132 Stigmasterol certified reference material, 10 mg/mL in chloroform human, rat pricing
S5442 SyntheChol® NS0 Supplement 500 ×, synthetic cholesterol, animal component-free, aqueous solution, sterile-filtered, suitable for cell culture human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016937 Rosetta Predictions human pricing
XM_001064735 Rosetta Predictions rat pricing
XM_242396 Rosetta Predictions rat pricing
NM_008892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138924 predicted 1499
2 SASI_Hs01_00138925 predicted 1927
3 SASI_Hs02_00349929 predicted 4370
4 SASI_Hs02_00349930 predicted 2218
5 SASI_Hs01_00138928 predicted 1136
6 SASI_Hs01_00138929 predicted 2382
7 SASI_Hs01_00138931 predicted 497
8 SASI_Hs01_00138932 predicted 575
9 SASI_Hs02_00349931 predicted 1771
10 SASI_Hs02_00349932 predicted 3744
11 SASI_Hs01_00138926 predicted 3861
12 SASI_Hs01_00138927 predicted 4037
13 SASI_Hs01_00138930 predicted 927
14 SASI_Hs01_00138933 predicted 2513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311593 predicted 4012
2 SASI_Rn02_00311594 predicted 3557
3 SASI_Rn02_00311595 predicted 1863
4 SASI_Rn02_00311596 predicted 1304
5 SASI_Rn02_00311597 predicted 4324
6 SASI_Rn02_00311598 predicted 4818
7 SASI_Rn02_00311599 predicted 4256
8 SASI_Rn02_00311600 predicted 3838
9 SASI_Rn02_00311601 predicted 4382
10 SASI_Rn02_00311602 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_242396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391689 predicted 4013
2 SASI_Rn02_00391690 predicted 3553
3 SASI_Rn02_00391691 predicted 1308
4 SASI_Rn02_00391692 predicted 4328
5 SASI_Rn02_00391693 predicted 4813
6 SASI_Rn02_00391694 predicted 4250
7 SASI_Rn02_00391695 predicted 3836
8 SASI_Rn02_00391696 predicted 4386
9 SASI_Rn02_00391697 predicted 4004
10 SASI_Rn02_00391698 predicted 4069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165005 predicted 3561
2 SASI_Mm02_00314904 predicted 1576
3 SASI_Mm01_00165006 predicted 3738
4 SASI_Mm01_00165007 predicted 1530
5 SASI_Mm01_00165008 predicted 1897
6 SASI_Mm01_00165009 predicted 3505
7 SASI_Mm01_00165010 predicted 4179
8 SASI_Mm01_00165011 predicted 1961
9 SASI_Mm01_00165012 predicted 1136
10 SASI_Mm01_00165013 predicted 4071
11 SASI_Mm01_00165014 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008892
VALIDATED
POLA1 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), alpha 1, catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-2630s21c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008892.1-2630s1c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-1583s1c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-3970s1c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-2766s1c1
Sequence:CCGGCCAAACTTAGAGATGGGCATTCTCGAGAATGCCCATCTCTAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-279s1c1
Sequence:CCGGCGTCAGGATGATGACTGGATTCTCGAGAATCCAGTCATCATCCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008892.1-4505s21c1
Sequence:CCGGCCTAACTGCTGCACCACTATCCTCGAGGATAGTGGTGCAGCAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-3970s21c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-1583s21c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008892.1-3775s21c1
Sequence:CCGGGACTTGACTCCACTCAATTTACTCGAGTAAATTGAGTGGAGTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008892
VALIDATED
POLA1 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), alpha 1, catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-2630s21c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008892.1-2630s1c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-1583s1c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-3970s1c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-2766s1c1
Sequence:CCGGCCAAACTTAGAGATGGGCATTCTCGAGAATGCCCATCTCTAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-279s1c1
Sequence:CCGGCGTCAGGATGATGACTGGATTCTCGAGAATCCAGTCATCATCCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008892.1-4505s21c1
Sequence:CCGGCCTAACTGCTGCACCACTATCCTCGAGGATAGTGGTGCAGCAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-3970s21c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-1583s21c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008892.1-3775s21c1
Sequence:CCGGGACTTGACTCCACTCAATTTACTCGAGTAAATTGAGTGGAGTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008892
VALIDATED
POLA1 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), alpha 1, catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-2630s21c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008892.1-2630s1c1
Sequence:CCGGCCTGGATTTCAACAGTTTATACTCGAGTATAAACTGTTGAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-1583s1c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-3970s1c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-2766s1c1
Sequence:CCGGCCAAACTTAGAGATGGGCATTCTCGAGAATGCCCATCTCTAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008892.1-279s1c1
Sequence:CCGGCGTCAGGATGATGACTGGATTCTCGAGAATCCAGTCATCATCCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008892.1-4505s21c1
Sequence:CCGGCCTAACTGCTGCACCACTATCCTCGAGGATAGTGGTGCAGCAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-3970s21c1
Sequence:CCGGCCAGTTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008892.1-1583s21c1
Sequence:CCGGGCCAATCAGTTGGTGTAAATTCTCGAGAATTTACACCAACTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008892.1-3775s21c1
Sequence:CCGGGACTTGACTCCACTCAATTTACTCGAGTAAATTGAGTGGAGTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016937
VALIDATED
POLA1 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), alpha 1, catalytic subunit
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-2726s1c2
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-2726s1c1
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-143s1c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-362s1c1
Sequence:CCGGCGCAATAAAGACAAGAGGAATCTCGAGATTCCTCTTGTCTTTATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-3930s1c1
Sequence:CCGGCCAGCTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-4133s1c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3240s21c1
Sequence:CCGGGAGCTCAAAGGATTAGATATACTCGAGTATATCTAATCCTTTGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3694s21c1
Sequence:CCGGGTGAACCAATAGACGGAATTGCTCGAGCAATTCCGTCTATTGGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-1918s21c1
Sequence:CCGGATATCATTGTGGGTCATAATACTCGAGTATTATGACCCACAATGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-150s21c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-2283s21c1
Sequence:CCGGCAGATCATGTGTGAGCTAAATCTCGAGATTTAGCTCACACATGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4140s21c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016937.2-4844s21c1
Sequence:CCGGGCCAATTAAACCCGGTCTAAACTCGAGTTTAGACCGGGTTTAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-4133s1c2
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4387s21c1
Sequence:CCGGTCGCTGGTTGTGCCGTGAAATCTCGAGATTTCACGGCACAACCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016937
VALIDATED
POLA1 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), alpha 1, catalytic subunit
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-2726s1c2
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-2726s1c1
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-143s1c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-362s1c1
Sequence:CCGGCGCAATAAAGACAAGAGGAATCTCGAGATTCCTCTTGTCTTTATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-3930s1c1
Sequence:CCGGCCAGCTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-4133s1c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3240s21c1
Sequence:CCGGGAGCTCAAAGGATTAGATATACTCGAGTATATCTAATCCTTTGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3694s21c1
Sequence:CCGGGTGAACCAATAGACGGAATTGCTCGAGCAATTCCGTCTATTGGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-1918s21c1
Sequence:CCGGATATCATTGTGGGTCATAATACTCGAGTATTATGACCCACAATGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-150s21c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-2283s21c1
Sequence:CCGGCAGATCATGTGTGAGCTAAATCTCGAGATTTAGCTCACACATGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4140s21c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016937.2-4844s21c1
Sequence:CCGGGCCAATTAAACCCGGTCTAAACTCGAGTTTAGACCGGGTTTAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-4133s1c2
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4387s21c1
Sequence:CCGGTCGCTGGTTGTGCCGTGAAATCTCGAGATTTCACGGCACAACCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016937
VALIDATED
POLA1 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), alpha 1, catalytic subunit
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-2726s1c2
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-2726s1c1
Sequence:CCGGCCAAGCTTAGAAATGGGCATTCTCGAGAATGCCCATTTCTAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-143s1c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-362s1c1
Sequence:CCGGCGCAATAAAGACAAGAGGAATCTCGAGATTCCTCTTGTCTTTATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-3930s1c1
Sequence:CCGGCCAGCTTGTATCGTTGCAGTACTCGAGTACTGCAACGATACAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016937.1-4133s1c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3240s21c1
Sequence:CCGGGAGCTCAAAGGATTAGATATACTCGAGTATATCTAATCCTTTGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-3694s21c1
Sequence:CCGGGTGAACCAATAGACGGAATTGCTCGAGCAATTCCGTCTATTGGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-1918s21c1
Sequence:CCGGATATCATTGTGGGTCATAATACTCGAGTATTATGACCCACAATGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-150s21c1
Sequence:CCGGGCTGGTGAGAAGTATAAATATCTCGAGATATTTATACTTCTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-2283s21c1
Sequence:CCGGCAGATCATGTGTGAGCTAAATCTCGAGATTTAGCTCACACATGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4140s21c1
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016937.2-4844s21c1
Sequence:CCGGGCCAATTAAACCCGGTCTAAACTCGAGTTTAGACCGGGTTTAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016937.1-4133s1c2
Sequence:CCGGGCCTGCATGAAAGCTACACTTCTCGAGAAGTGTAGCTTTCATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016937.2-4387s21c1
Sequence:CCGGTCGCTGGTTGTGCCGTGAAATCTCGAGATTTCACGGCACAACCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)