POLA2

polymerase (DNA directed), alpha 2, accessory subunit

54 Gene Product Result for

Species: Human POLA2(23649), Mouse Pola2(18969), Rat Pola2(85242), Thale Cress POLA2(843086), dog POLA2(476025), Horse POLA2(100051254), domestic cat POLA2(101084827), Zebrafish pola2(322059), chicken POLA2(100858476), naked mole-rat Pola2(101725812), Domestic Rabbit POLA2(100355173), domestic guinea pig Pola2(100727306), cow POLA2(514793), sheep POLA2(101107399)

UniProtKB ID: Q14181, Q9BPV3

Gene ID:

Human(23649)

Mouse(18969) polymerase (DNA directed), alpha 2

Rat(85242) polymerase (DNA directed), alpha 2, accessory subunit

Thale Cress(843086) DNA polymerase alpha 2

dog(476025) polymerase (DNA directed), alpha 2, accessory subunit

Horse(100051254) polymerase (DNA directed), alpha 2, accessory subunit

domestic cat(101084827) polymerase (DNA directed), alpha 2, accessory subunit

Zebrafish(322059) polymerase (DNA directed), alpha 2

chicken(100858476) polymerase (DNA directed), alpha 2, accessory subunit

naked mole-rat(101725812) polymerase (DNA directed), alpha 2, accessory subunit

Domestic Rabbit(100355173) polymerase (DNA directed), alpha 2, accessory subunit

domestic guinea pig(100727306) polymerase (DNA directed), alpha 2, accessory subunit

cow(514793) polymerase (DNA directed), alpha 2 (70kD subunit)

sheep(101107399) polymerase (DNA directed), alpha 2, accessory subunit

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1410440	Anti-POLA2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

HPA037570	Anti-POLA2 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

SAB1404988	Monoclonal Anti-POLA2 antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunoprecipitation (IP), western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

C7495	Clofarabine ≥98% (HPLC)	human	pricing

PHR1787	Cytarabine Pharmaceutical Secondary Standard; Certified Reference Material	human	pricing

C3350000	Cytarabine European Pharmacopoeia (EP) Reference Standard	human	pricing

1162002	Cytarabine United States Pharmacopeia (USP) Reference Standard	human	pricing

BP383	Cytarabine British Pharmacopoeia (BP) Reference Standard	human	pricing

V900339	Cytosine β-D-arabinofuranoside Vetec^™, reagent grade, 90%	human	pricing

C6645	Cytosine β-D-arabinofuranoside hydrochloride crystalline	human	pricing

G6423	Gemcitabine hydrochloride ≥98% (HPLC)	human	pricing

1288463	Gemcitabine hydrochloride United States Pharmacopeia (USP) Reference Standard	human	pricing

Y0000675	Gemcitabine hydrochloride European Pharmacopoeia (EP) Reference Standard	human	pricing

C1768	Cytosine β-D-arabinofuranoside crystalline, ≥90% (HPLC)	human, mouse	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST80491	PrEST Antigen POLA2 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST26666	SILu^™PrEST DPOA2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR03606	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, POLA2	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_008893	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_008893	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_008893	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_002689	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_002689	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_002689	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU042241	MISSION^® esiRNA targeting human POLA2	human	pricing

EMU004411	MISSION^® esiRNA targeting mouse Pola2	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_002689	Rosetta Predictions	human	pricing
NM_053480	Rosetta Predictions	rat	pricing
NM_008893	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_002689	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?	Price
1	SASI_Hs02_00334255 predicted	1900	154.00
2	SASI_Hs01_00177968 predicted	622	154.00
3	SASI_Hs01_00177970 predicted	1134	154.00
4	SASI_Hs01_00177971 predicted	1388	154.00
5	SASI_Hs01_00177972 predicted	1341	154.00
6	SASI_Hs01_00177973 predicted	513	154.00
7	SASI_Hs01_00177974 predicted	876	154.00
8	SASI_Hs01_00177975 predicted	2216	154.00
9	SASI_Hs02_00334256 predicted	907	154.00
10	SASI_Hs02_00334257 predicted	1179	154.00
11	SASI_Hs01_00177967 predicted	939	154.00
12	SASI_Hs01_00177969 predicted	987	154.00
13	SASI_Hs01_00177976 predicted	1917	154.00

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_053480	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?	Price
1	SASI_Rn01_00108984 predicted	395	154.00
2	SASI_Rn01_00108985 predicted	410	154.00
3	SASI_Rn01_00108986 predicted	1917	154.00
4	SASI_Rn01_00108987 predicted	1223	154.00
5	SASI_Rn01_00108988 predicted	887	154.00
6	SASI_Rn01_00108989 predicted	1064	154.00
7	SASI_Rn01_00108990 predicted	1149	154.00
8	SASI_Rn01_00108991 predicted	1434	154.00
9	SASI_Rn01_00108992 predicted	766	154.00
10	SASI_Rn01_00108993 predicted	411	154.00

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_008893	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?	Price
1	SASI_Mm01_00185046 predicted	921	154.00
2	SASI_Mm02_00314905 predicted	1775	154.00
3	SASI_Mm01_00185047 predicted	1208	154.00
4	SASI_Mm01_00185048 predicted	1250	154.00
5	SASI_Mm01_00185049 predicted	882	154.00
6	SASI_Mm01_00185050 predicted	1041	154.00
7	SASI_Mm01_00185052 predicted	2059	154.00
8	SASI_Mm02_00314906 predicted	1922	154.00
9	SASI_Mm01_00185054 predicted	1628	154.00
10	SASI_Mm01_00185055 predicted	1302	154.00
11	SASI_Mm01_00185051 predicted	438	154.00
12	SASI_Mm01_00185053 predicted	1220	154.00

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_008893 VALIDATED	POLA2 MISSION shRNA Bacterial Glycerol Stock polymerase (DNA directed), alpha 2, accessory subunit	Mouse

13 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000375268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-913s21c1
	Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366404
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1039s21c1
	Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1861s21c1
	Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1190s21c1
	Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1096s21c1
	Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120323
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1253s1c1
	Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120326
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1903s1c1
	Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120322
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008893.2-2242s1c1
	Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120325
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-610s1c1
	Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120324
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-609s1c1
	Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1677s21c1
	Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-2164s21c1
	Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1924s21c1
	Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_008893 VALIDATED	POLA2 MISSION shRNA shRNA Plasmid DNA polymerase (DNA directed), alpha 2, accessory subunit	Mouse

13 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000375268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-913s21c1
	Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000366404
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1039s21c1
	Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000375204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1861s21c1
	Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000366471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1190s21c1
	Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000366470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1096s21c1
	Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120323
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1253s1c1
	Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120326
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1903s1c1
	Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120322
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008893.2-2242s1c1
	Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120325
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-610s1c1
	Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000120324
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-609s1c1
	Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000375269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1677s21c1
	Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000366403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-2164s21c1
	Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000366472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1924s21c1
	Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_008893 VALIDATED	POLA2 MISSION shRNA Lentiviral Transduction Particles polymerase (DNA directed), alpha 2, accessory subunit	Mouse

13 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000375268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-913s21c1
	Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366404
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1039s21c1
	Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375204
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1861s21c1
	Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366471
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1190s21c1
	Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_008893.3-1096s21c1
	Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120323
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1253s1c1
	Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120326
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-1903s1c1
	Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120322
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008893.2-2242s1c1
	Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120325
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-610s1c1
	Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000120324
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_008893.2-609s1c1
	Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1677s21c1
	Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.81	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-2164s21c1
	Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000366472
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_008893.3-1924s21c1
	Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_002689 VALIDATED	POLA2 MISSION shRNA Bacterial Glycerol Stock polymerase (DNA directed), alpha 2, accessory subunit	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350651
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-394s21c1
	Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322913
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.54	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-2161s21c1
	Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322915
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-1901s21c1
	Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-460s21c1
	Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053075
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-1195s1c1
	Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053073
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-494s1c1
	Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053074
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1725s1c1
	Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053077
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1787s1c1
	Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-944s21c1
	Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053076
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-815s1c1
	Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_002689 VALIDATED	POLA2 MISSION shRNA shRNA Plasmid DNA polymerase (DNA directed), alpha 2, accessory subunit	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350651
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-394s21c1
	Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322913
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.54	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-2161s21c1
	Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322915
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-1901s21c1
	Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-460s21c1
	Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000053075
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-1195s1c1
	Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000053073
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-494s1c1
	Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000053074
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1725s1c1
	Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000053077
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1787s1c1
	Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000322846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-944s21c1
	Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000053076
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-815s1c1
	Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_002689 VALIDATED	POLA2 MISSION shRNA Lentiviral Transduction Particles polymerase (DNA directed), alpha 2, accessory subunit	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000350651
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-394s21c1
	Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322913
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.54	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-2161s21c1
	Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322915
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-1901s21c1
	Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322914
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_002689.2-460s21c1
	Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053075
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-1195s1c1
	Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053073
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_002689.2-494s1c1
	Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053074
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1725s1c1
	Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053077
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-1787s1c1
	Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000322846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: 293T/17
	TRC Version: 2	Clone ID:NM_002689.2-944s21c1
	Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000053076
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: 293T/17
	TRC Version: 1	Clone ID:NM_002689.2-815s1c1
	Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart