EMAIL THIS PAGE TO A FRIEND

POLA2

polymerase (DNA directed), alpha 2, accessory subunit

54 Gene Product Result for
UniProtKB ID: Q14181, Q9BPV3
Gene ID:
Mouse(18969) polymerase (DNA directed), alpha 2
Rat(85242) polymerase (DNA directed), alpha 2, accessory subunit
Thale Cress(843086) DNA polymerase alpha 2
dog(476025) polymerase (DNA directed), alpha 2, accessory subunit
Horse(100051254) polymerase (DNA directed), alpha 2, accessory subunit
domestic cat(101084827) polymerase (DNA directed), alpha 2, accessory subunit
Zebrafish(322059) polymerase (DNA directed), alpha 2
chicken(100858476) polymerase (DNA directed), alpha 2, accessory subunit
naked mole-rat(101725812) polymerase (DNA directed), alpha 2, accessory subunit
Domestic Rabbit(100355173) polymerase (DNA directed), alpha 2, accessory subunit
domestic guinea pig(100727306) polymerase (DNA directed), alpha 2, accessory subunit
cow(514793) polymerase (DNA directed), alpha 2 (70kD subunit)
sheep(101107399) polymerase (DNA directed), alpha 2, accessory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002689 Rosetta Predictions human pricing
NM_053480 Rosetta Predictions rat pricing
NM_008893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334255 predicted 1900
2 SASI_Hs01_00177968 predicted 622
3 SASI_Hs01_00177970 predicted 1134
4 SASI_Hs01_00177971 predicted 1388
5 SASI_Hs01_00177972 predicted 1341
6 SASI_Hs01_00177973 predicted 513
7 SASI_Hs01_00177974 predicted 876
8 SASI_Hs01_00177975 predicted 2216
9 SASI_Hs02_00334256 predicted 907
10 SASI_Hs02_00334257 predicted 1179
11 SASI_Hs01_00177967 predicted 939
12 SASI_Hs01_00177969 predicted 987
13 SASI_Hs01_00177976 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108984 predicted 395
2 SASI_Rn01_00108985 predicted 410
3 SASI_Rn01_00108986 predicted 1917
4 SASI_Rn01_00108987 predicted 1223
5 SASI_Rn01_00108988 predicted 887
6 SASI_Rn01_00108989 predicted 1064
7 SASI_Rn01_00108990 predicted 1149
8 SASI_Rn01_00108991 predicted 1434
9 SASI_Rn01_00108992 predicted 766
10 SASI_Rn01_00108993 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185046 predicted 921
2 SASI_Mm02_00314905 predicted 1775
3 SASI_Mm01_00185047 predicted 1208
4 SASI_Mm01_00185048 predicted 1250
5 SASI_Mm01_00185049 predicted 882
6 SASI_Mm01_00185050 predicted 1041
7 SASI_Mm01_00185052 predicted 2059
8 SASI_Mm02_00314906 predicted 1922
9 SASI_Mm01_00185054 predicted 1628
10 SASI_Mm01_00185055 predicted 1302
11 SASI_Mm01_00185051 predicted 438
12 SASI_Mm01_00185053 predicted 1220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008893
VALIDATED
POLA2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), alpha 2, accessory subunit
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-913s21c1
Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1039s21c1
Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1861s21c1
Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1190s21c1
Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1096s21c1
Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1253s1c1
Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1903s1c1
Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008893.2-2242s1c1
Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-610s1c1
Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-609s1c1
Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1677s21c1
Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-2164s21c1
Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1924s21c1
Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008893
VALIDATED
POLA2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), alpha 2, accessory subunit
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-913s21c1
Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000366404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1039s21c1
Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000375204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1861s21c1
Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000366471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1190s21c1
Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000366470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1096s21c1
Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1253s1c1
Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1903s1c1
Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008893.2-2242s1c1
Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-610s1c1
Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-609s1c1
Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000375269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1677s21c1
Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000366403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-2164s21c1
Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000366472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1924s21c1
Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008893
VALIDATED
POLA2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), alpha 2, accessory subunit
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-913s21c1
Sequence:CCGGGCAGCTACAAAGCGATGTTTCCTCGAGGAAACATCGCTTTGTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1039s21c1
Sequence:CCGGCAGCGCAAGAGCCTGTTATTCCTCGAGGAATAACAGGCTCTTGCGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1861s21c1
Sequence:CCGGTAGACTACGAGAACTTCTATACTCGAGTATAGAAGTTCTCGTAGTCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1190s21c1
Sequence:CCGGCTTCCCTGGACAGGTTGTAATCTCGAGATTACAACCTGTCCAGGGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008893.3-1096s21c1
Sequence:CCGGTGAACAGCAAGTCCGTGATTCCTCGAGGAATCACGGACTTGCTGTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1253s1c1
Sequence:CCGGCCGTTCTATCAGCCTACTGAACTCGAGTTCAGTAGGCTGATAGAACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-1903s1c1
Sequence:CCGGCGAGCTGAGATACTTTGTGAACTCGAGTTCACAAAGTATCTCAGCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008893.2-2242s1c1
Sequence:CCGGGCGTGGCTCTGATCTGAATTACTCGAGTAATTCAGATCAGAGCCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-610s1c1
Sequence:CCGGCTCTTATACCACACCCTCTAACTCGAGTTAGAGGGTGTGGTATAAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008893.2-609s1c1
Sequence:CCGGGCTCTTATACCACACCCTCTACTCGAGTAGAGGGTGTGGTATAAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000375269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1677s21c1
Sequence:CCGGCCCTGCAGCCTCTCCATAAATCTCGAGATTTATGGAGAGGCTGCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-2164s21c1
Sequence:CCGGTGGCCAAACTGTTGGAGTACCCTCGAGGGTACTCCAACAGTTTGGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008893.3-1924s21c1
Sequence:CCGGCGTCCGAGCTGAGATACTTTGCTCGAGCAAAGTATCTCAGCTCGGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002689
VALIDATED
POLA2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), alpha 2, accessory subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-394s21c1
Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-2161s21c1
Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-1901s21c1
Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-460s21c1
Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-1195s1c1
Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-494s1c1
Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1725s1c1
Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1787s1c1
Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-944s21c1
Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-815s1c1
Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002689
VALIDATED
POLA2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), alpha 2, accessory subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-394s21c1
Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-2161s21c1
Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-1901s21c1
Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-460s21c1
Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000053075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-1195s1c1
Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000053073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-494s1c1
Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000053074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1725s1c1
Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000053077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1787s1c1
Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000322846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-944s21c1
Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000053076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-815s1c1
Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002689
VALIDATED
POLA2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), alpha 2, accessory subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-394s21c1
Sequence:CCGGGACTGCGAGGAGGCTCTAATTCTCGAGAATTAGAGCCTCCTCGCAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-2161s21c1
Sequence:CCGGTCTGCTGTGTGGGCCCTTAAACTCGAGTTTAAGGGCCCACACAGCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-1901s21c1
Sequence:CCGGTTGACTATGAGTCGTTCTATGCTCGAGCATAGAACGACTCATAGTCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002689.2-460s21c1
Sequence:CCGGGGAATGGTAGGCGAGCTTATACTCGAGTATAAGCTCGCCTACCATTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-1195s1c1
Sequence:CCGGCCAGTGGATTTATCTGAGCTTCTCGAGAAGCTCAGATAAATCCACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002689.2-494s1c1
Sequence:CCGGGCACACATAAAGTTGGCCTTACTCGAGTAAGGCCAACTTTATGTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1725s1c1
Sequence:CCGGCCTCTCCATAAACGGAGTGATCTCGAGATCACTCCGTTTATGGAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-1787s1c1
Sequence:CCGGCCGAGGAGATCAGTAGTTCTTCTCGAGAAGAACTACTGATCTCCTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000322846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002689.2-944s21c1
Sequence:CCGGCACTAACTGGGAGCTACAAATCTCGAGATTTGTAGCTCCCAGTTAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002689.2-815s1c1
Sequence:CCGGCCCAGAAATACAACTCACGAACTCGAGTTCGTGAGTTGTATTTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???