EMAIL THIS PAGE TO A FRIEND

POLB

polymerase (DNA directed), beta

79 Gene Product Result for
UniProtKB ID: P06746, B2RC78, Q3KP48, Q6FI34
Gene ID:
Human(5423) Summary: The protein encoded by this gene is a DNA polymerase involved in base excision and repair, also called gap-filling DNA synthesis. The encoded protein, acting as a monomer, is normally found in the cytoplasm, but it translocates to the nucleus upon DNA damage. Several transcript variants of this gene exist, but the full-length nature of only one has been described to date. [provided by RefSeq, Sep 2011]
Mouse(18970) polymerase (DNA directed), beta
Rat(29240) polymerase (DNA directed), beta
Zebrafish(554204) polymerase (DNA directed), beta
chicken(426794) polymerase (DNA directed), beta
dog(494001) polymerase (DNA directed), beta
domestic cat(101099797) polymerase (DNA directed), beta
cow(614688) polymerase (DNA directed), beta
Goat(100861100) polymerase (DNA directed), beta
sheep(101122327) polymerase (DNA directed), beta
domestic guinea pig(100731356) polymerase (DNA directed), beta
Domestic Rabbit(100348691) polymerase (DNA directed), beta
naked mole-rat(101710722) polymerase (DNA directed), beta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502236 Anti-DNA Polymerase β antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1400217 Anti-POLB antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA049104 Anti-POLB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002690 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002690 Rosetta Predictions human pricing
NM_017141 Rosetta Predictions rat pricing
XM_579396 Rosetta Predictions rat pricing
NM_011130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027526 predicted 876
2 SASI_Hs01_00027527 predicted 913
3 SASI_Hs01_00027528 predicted 569
4 SASI_Hs01_00027529 predicted 516
5 SASI_Hs01_00027530 predicted 868
6 SASI_Hs01_00027531 predicted 381
7 SASI_Hs02_00334258 predicted 446
8 SASI_Hs01_00027532 predicted 200
9 SASI_Hs01_00027533 predicted 578
10 SASI_Hs01_00027534 predicted 287
11 SASI_Hs01_00027535 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261392 predicted 668
2 SASI_Rn02_00261393 predicted 825
3 SASI_Rn01_00089506 predicted 278
4 SASI_Rn02_00261394 predicted 472
5 SASI_Rn01_00089508 predicted 772
6 SASI_Rn02_00261395 predicted 623
7 SASI_Rn02_00261396 predicted 605
8 SASI_Rn02_00261397 predicted 341
9 SASI_Rn02_00261398 predicted 463
10 SASI_Rn02_00261399 predicted 755
11 SASI_Rn01_00089501 predicted 368
12 SASI_Rn01_00089502 predicted 1074
13 SASI_Rn01_00089503 predicted 827
14 SASI_Rn01_00089504 predicted 417
15 SASI_Rn01_00089505 predicted 1063
16 SASI_Rn01_00089507 predicted 1049
17 SASI_Rn01_00089509 predicted 1102
18 SASI_Rn01_00089510 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151090 predicted 322
2 SASI_Rn01_00151091 predicted 371
3 SASI_Rn01_00151092 predicted 416
4 SASI_Rn01_00151093 predicted 414
5 SASI_Rn01_00151094 predicted 283
6 SASI_Rn01_00151095 predicted 329
7 SASI_Rn01_00151096 predicted 414
8 SASI_Rn01_00151097 predicted 304
9 SASI_Rn01_00151098 predicted 336
10 SASI_Rn01_00151099 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200800 predicted 396
2 SASI_Mm01_00200801 predicted 545
3 SASI_Mm01_00200803 predicted 307
4 SASI_Mm01_00200804 predicted 796
5 SASI_Mm01_00200805 predicted 214
6 SASI_Mm01_00200807 predicted 444
7 SASI_Mm02_00319947 predicted 446
8 SASI_Mm01_00200808 predicted 513
9 SASI_Mm01_00200809 predicted 316
10 SASI_Mm02_00319948 predicted 652
11 SASI_Mm01_00200802 predicted 455
12 SASI_Mm01_00200806 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002690
VALIDATED
POLB MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-444s1c1
Sequence:CCGGGCAAGGAAGTTTGTAGATGAACTCGAGTTCATCTACAAACTTCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-706s1c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-794s1c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-288s1c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-168s1c1
Sequence:CCGGCTCACAGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-794s21c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-706s21c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-288s21c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-508s21c1
Sequence:CCGGTGAACCATCATCAGCGAATTGCTCGAGCAATTCGCTGATGATGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-925s21c1
Sequence:CCGGATTTCACTGGGAGTGATATTTCTCGAGAAATATCACTCCCAGTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002690
VALIDATED
POLB MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-444s1c1
Sequence:CCGGGCAAGGAAGTTTGTAGATGAACTCGAGTTCATCTACAAACTTCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-706s1c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-794s1c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-288s1c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-168s1c1
Sequence:CCGGCTCACAGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-794s21c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-706s21c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-288s21c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-508s21c1
Sequence:CCGGTGAACCATCATCAGCGAATTGCTCGAGCAATTCGCTGATGATGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-925s21c1
Sequence:CCGGATTTCACTGGGAGTGATATTTCTCGAGAAATATCACTCCCAGTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002690
VALIDATED
POLB MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-444s1c1
Sequence:CCGGGCAAGGAAGTTTGTAGATGAACTCGAGTTCATCTACAAACTTCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-706s1c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-794s1c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002690.1-288s1c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002690.1-168s1c1
Sequence:CCGGCTCACAGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-794s21c1
Sequence:CCGGCCTGTCAAAGGGTGAGACAAACTCGAGTTTGTCTCACCCTTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-706s21c1
Sequence:CCGGCCAGCTTCACTTCAGAATCAACTCGAGTTGATTCTGAAGTGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-288s21c1
Sequence:CCGGGCTAAGAAATTGCCTGGAGTACTCGAGTACTCCAGGCAATTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-508s21c1
Sequence:CCGGTGAACCATCATCAGCGAATTGCTCGAGCAATTCGCTGATGATGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002690.1-925s21c1
Sequence:CCGGATTTCACTGGGAGTGATATTTCTCGAGAAATATCACTCCCAGTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011130
VALIDATED
POLB MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), beta
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011130.1-95s21c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-215s1c1
Sequence:CCGGGCTAAGAAACTGCCAGGAGTACTCGAGTACTCCTGGCAGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-457s1c1
Sequence:CCGGGCTGAAATATTTCGAGGACTTCTCGAGAAGTCCTCGAAATATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-662s1c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-629s1c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011130.1-95s1c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-435s21c1
Sequence:CCGGTGAACCATCATCAACGAATTGCTCGAGCAATTCGTTGATGATGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-629s21c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.2-468s21c1
Sequence:CCGGTCAACGAATTGGGCTGAAATACTCGAGTATTTCAGCCCAATTCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-790s21c1
Sequence:CCGGTCCACACAGGAGAATCGATATCTCGAGATATCGATTCTCCTGTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-662s21c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011130
VALIDATED
POLB MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), beta
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011130.1-95s21c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-215s1c1
Sequence:CCGGGCTAAGAAACTGCCAGGAGTACTCGAGTACTCCTGGCAGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-457s1c1
Sequence:CCGGGCTGAAATATTTCGAGGACTTCTCGAGAAGTCCTCGAAATATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-662s1c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-629s1c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011130.1-95s1c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-435s21c1
Sequence:CCGGTGAACCATCATCAACGAATTGCTCGAGCAATTCGTTGATGATGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-629s21c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.2-468s21c1
Sequence:CCGGTCAACGAATTGGGCTGAAATACTCGAGTATTTCAGCCCAATTCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-790s21c1
Sequence:CCGGTCCACACAGGAGAATCGATATCTCGAGATATCGATTCTCCTGTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-662s21c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011130
VALIDATED
POLB MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), beta
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011130.1-95s21c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-215s1c1
Sequence:CCGGGCTAAGAAACTGCCAGGAGTACTCGAGTACTCCTGGCAGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-457s1c1
Sequence:CCGGGCTGAAATATTTCGAGGACTTCTCGAGAAGTCCTCGAAATATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-662s1c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011130.1-629s1c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011130.1-95s1c1
Sequence:CCGGCTCGTGGAACTCGCAAACTTTCTCGAGAAAGTTTGCGAGTTCCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-435s21c1
Sequence:CCGGTGAACCATCATCAACGAATTGCTCGAGCAATTCGTTGATGATGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-629s21c1
Sequence:CCGGCACCCAAACTTCACGTCAGAACTCGAGTTCTGACGTGAAGTTTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.2-468s21c1
Sequence:CCGGTCAACGAATTGGGCTGAAATACTCGAGTATTTCAGCCCAATTCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-790s21c1
Sequence:CCGGTCCACACAGGAGAATCGATATCTCGAGATATCGATTCTCCTGTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011130.1-662s21c1
Sequence:CCGGCCAAAGTTGTTACATCGTGTTCTCGAGAACACGATGTAACAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)