EMAIL THIS PAGE TO A FRIEND

POLD1

polymerase (DNA directed), delta 1, catalytic subunit

65 Gene Product Result for
Synonyms: CDC2 CRCS10 MDPL POLD
UniProtKB ID: P28340, Q8NER3, Q96H98
Gene ID:
Human(5424) Summary: This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
Mouse(18971) polymerase (DNA directed), delta 1, catalytic subunit
Rat(59294) polymerase (DNA directed), delta 1, catalytic subunit
naked mole-rat(101699680) polymerase (DNA directed), delta 1, catalytic subunit
domestic guinea pig(100719673) polymerase (DNA directed), delta 1, catalytic subunit
cow(281990) polymerase (DNA directed), delta 1, catalytic subunit
sheep(101117012) polymerase (DNA directed), delta 1, catalytic subunit
Zebrafish(556456) polymerase (DNA directed), delta 1, catalytic subunit
Horse(100052455) polymerase (DNA directed), delta 1, catalytic subunit
domestic cat(101086519) polymerase (DNA directed), delta 1, catalytic subunit
dog(610047) polymerase (DNA directed), delta 1, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002691 Rosetta Predictions human pricing
NM_021662 Rosetta Predictions rat pricing
NM_011131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334259 predicted 822
2 SASI_Hs01_00150049 predicted 2453
3 SASI_Hs01_00150051 predicted 2642
4 SASI_Hs01_00150052 predicted 3165
5 SASI_Hs02_00334260 predicted 1348
6 SASI_Hs01_00150053 predicted 345
7 SASI_Hs01_00150054 predicted 1986
8 SASI_Hs01_00150055 predicted 1493
9 SASI_Hs01_00150056 predicted 1869
10 SASI_Hs01_00150057 predicted 2903
11 SASI_Hs01_00150048 predicted 1290
12 SASI_Hs01_00150050 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047758 predicted 2814
2 SASI_Rn01_00047759 predicted 1466
3 SASI_Rn01_00047760 predicted 1563
4 SASI_Rn01_00047761 predicted 1879
5 SASI_Rn01_00047762 predicted 2577
6 SASI_Rn01_00047763 predicted 1173
7 SASI_Rn01_00047764 predicted 2684
8 SASI_Rn01_00047765 predicted 2122
9 SASI_Rn01_00047766 predicted 2516
10 SASI_Rn01_00047767 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319949 predicted 2445
2 SASI_Mm02_00319950 predicted 823
3 SASI_Mm02_00319951 predicted 824
4 SASI_Mm02_00319952 predicted 1938
5 SASI_Mm02_00319953 predicted 1288
6 SASI_Mm02_00319954 predicted 2184
7 SASI_Mm02_00319955 predicted 1892
8 SASI_Mm02_00319956 predicted 2722
9 SASI_Mm02_00319957 predicted 2826
10 SASI_Mm02_00319958 predicted 3113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011131
POLD1 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), delta 1, catalytic subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-786s21c1
Sequence:CCGGACGAAGCCAACGTGGACTTTGCTCGAGCAAAGTCCACGTTGGCTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-1615s21c1
Sequence:CCGGCCGACTACTAGAGCGCCTTATCTCGAGATAAGGCGCTCTAGTAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-2463s21c1
Sequence:CCGGTCATCAGCAAGAAGCGCTATGCTCGAGCATAGCGCTTCTTGCTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2696s1c1
Sequence:CCGGGCTGGTCATCACCAAAGAGTTCTCGAGAACTCTTTGGTGATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-348s1c1
Sequence:CCGGCAGCTGGAGATTGACCACTATCTCGAGATAGTGGTCAATCTCCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-1238s1c1
Sequence:CCGGCGGCTACAACATTCAGAACTTCTCGAGAAGTTCTGAATGTTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2429s1c1
Sequence:CCGGGCTGGAGTTCGAGAAGGTTTACTCGAGTAAACCTTCTCGAACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-3102s1c1
Sequence:CCGGCGCTCCGTAATCGACCATCAACTCGAGTTGATGGTCGATTACGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011131
POLD1 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), delta 1, catalytic subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-786s21c1
Sequence:CCGGACGAAGCCAACGTGGACTTTGCTCGAGCAAAGTCCACGTTGGCTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-1615s21c1
Sequence:CCGGCCGACTACTAGAGCGCCTTATCTCGAGATAAGGCGCTCTAGTAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-2463s21c1
Sequence:CCGGTCATCAGCAAGAAGCGCTATGCTCGAGCATAGCGCTTCTTGCTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2696s1c1
Sequence:CCGGGCTGGTCATCACCAAAGAGTTCTCGAGAACTCTTTGGTGATGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-348s1c1
Sequence:CCGGCAGCTGGAGATTGACCACTATCTCGAGATAGTGGTCAATCTCCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-1238s1c1
Sequence:CCGGCGGCTACAACATTCAGAACTTCTCGAGAAGTTCTGAATGTTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2429s1c1
Sequence:CCGGGCTGGAGTTCGAGAAGGTTTACTCGAGTAAACCTTCTCGAACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-3102s1c1
Sequence:CCGGCGCTCCGTAATCGACCATCAACTCGAGTTGATGGTCGATTACGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011131
POLD1 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), delta 1, catalytic subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-786s21c1
Sequence:CCGGACGAAGCCAACGTGGACTTTGCTCGAGCAAAGTCCACGTTGGCTTCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-1615s21c1
Sequence:CCGGCCGACTACTAGAGCGCCTTATCTCGAGATAAGGCGCTCTAGTAGTCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011131.3-2463s21c1
Sequence:CCGGTCATCAGCAAGAAGCGCTATGCTCGAGCATAGCGCTTCTTGCTGATGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2696s1c1
Sequence:CCGGGCTGGTCATCACCAAAGAGTTCTCGAGAACTCTTTGGTGATGACCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-348s1c1
Sequence:CCGGCAGCTGGAGATTGACCACTATCTCGAGATAGTGGTCAATCTCCAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-1238s1c1
Sequence:CCGGCGGCTACAACATTCAGAACTTCTCGAGAAGTTCTGAATGTTGTAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-2429s1c1
Sequence:CCGGGCTGGAGTTCGAGAAGGTTTACTCGAGTAAACCTTCTCGAACTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011131.2-3102s1c1
Sequence:CCGGCGCTCCGTAATCGACCATCAACTCGAGTTGATGGTCGATTACGGAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002691
VALIDATED
POLD1 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), delta 1, catalytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-2903s21c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-167s21c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1199s21c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-164s1c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-2459s1c1
Sequence:CCGGGCTTATCAGCAAGAAGCGCTACTCGAGTAGCGCTTCTTGCTGATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1196s1c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-2900s1c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1238s21c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1235s1c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002691
VALIDATED
POLD1 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), delta 1, catalytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-2903s21c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-167s21c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1199s21c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-164s1c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-2459s1c1
Sequence:CCGGGCTTATCAGCAAGAAGCGCTACTCGAGTAGCGCTTCTTGCTGATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1196s1c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-2900s1c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1238s21c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1235s1c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002691
VALIDATED
POLD1 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), delta 1, catalytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-2903s21c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-167s21c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1199s21c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-164s1c1
Sequence:CCGGCCTGGCACTGATGGAGGAGATCTCGAGATCTCCTCCATCAGTGCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_002691.1-2459s1c1
Sequence:CCGGGCTTATCAGCAAGAAGCGCTACTCGAGTAGCGCTTCTTGCTGATAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1196s1c1
Sequence:CCGGGTCCACCTTCATCCGTATCATCTCGAGATGATACGGATGAAGGTGGACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-2900s1c1
Sequence:CCGGCCTGCCCATTGACACGCAGTACTCGAGTACTGCGTGTCAATGGGCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002691.2-1238s21c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002691.1-1235s1c1
Sequence:CCGGCGGTTACAACATCCAGAACTTCTCGAGAAGTTCTGGATGTTGTAACCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???