EMAIL THIS PAGE TO A FRIEND

POLD4

polymerase (DNA-directed), delta 4, accessory subunit

58 Gene Product Result for
Synonyms: POLDS p12
UniProtKB ID: Q9HCU8, F5H506
Gene ID:
Human(57804) Summary: This gene encodes the smallest subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein enhances the activity of DNA polymerase delta and plays a role in fork repair and stabilization through interactions with the DNA helicase Bloom syndrome protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(69745) polymerase (DNA-directed), delta 4
Rat(361698) polymerase (DNA-directed), delta 4, accessory subunit
cow(617899) polymerase (DNA-directed), delta 4
sheep(101118743) polymerase (DNA-directed), delta 4, accessory subunit
domestic guinea pig(100732830) polymerase (DNA-directed), delta 4, accessory subunit
naked mole-rat(101706646) polymerase (DNA-directed), delta 4, accessory subunit
Thale Cress(837513) DNA polymerase delta subunit 4
dog(611847) polymerase (DNA-directed), delta 4, accessory subunit
domestic cat(101091308) polymerase (DNA-directed), delta 4, accessory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031161 MISSION® esiRNA esiRNA human POLD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021173 Rosetta Predictions human pricing
NM_001013195 Rosetta Predictions rat pricing
NM_027196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122668 predicted 603
2 SASI_Hs01_00122671 predicted 489
3 SASI_Hs02_00354727 predicted 352
4 SASI_Hs01_00122676 predicted 483
5 SASI_Hs02_00354728 predicted 598
6 SASI_Hs02_00354729 predicted 566
7 SASI_Hs02_00354730 predicted 292
8 SASI_Hs02_00354731 predicted 596
9 SASI_Hs02_00354732 predicted 496
10 SASI_Hs02_00354733 predicted 490
11 SASI_Hs01_00122669 predicted 674
12 SASI_Hs01_00122670 predicted 518
13 SASI_Hs01_00122672 predicted 663
14 SASI_Hs01_00122673 predicted 653
15 SASI_Hs01_00122674 predicted 658
16 SASI_Hs01_00122675 predicted 673
17 SASI_Hs01_00122677 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080469 predicted 424
2 SASI_Rn01_00080470 predicted 489
3 SASI_Rn01_00080471 predicted 507
4 SASI_Rn01_00080472 predicted 558
5 SASI_Rn01_00080473 predicted 481
6 SASI_Rn01_00080474 predicted 437
7 SASI_Rn01_00080476 predicted 380
8 SASI_Rn01_00080477 predicted 402
9 SASI_Rn01_00080478 predicted 504
10 SASI_Rn02_00200959 predicted 253
11 SASI_Rn01_00080475 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150494 predicted 324
2 SASI_Mm01_00150495 predicted 321
3 SASI_Mm01_00150496 predicted 328
4 SASI_Mm01_00150497 predicted 426
5 SASI_Mm01_00150498 predicted 527
6 SASI_Mm01_00150499 predicted 523
7 SASI_Mm01_00150500 predicted 428
8 SASI_Mm02_00331742 predicted 481
9 SASI_Mm01_00150501 predicted 452
10 SASI_Mm01_00150502 predicted 319
11 SASI_Mm01_00150503 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021173
POLD4 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta 4, accessory subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-220s1c1
Sequence:CCGGTGAGGCAGTTTGACCTGGCCTCTCGAGAGGCCAGGTCAAACTGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-358s1c1
Sequence:CCGGCCCGCTTCCAGTGCAGTCTCTCTCGAGAGAGACTGCACTGGAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-107s1c1
Sequence:CCGGCCCGGTTGTGAAGAGGAGGGACTCGAGTCCCTCCTCTTCACAACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c1
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-103s1c1
Sequence:CCGGCCTACCCGGTTGTGAAGAGGACTCGAGTCCTCTTCACAACCGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021173.3-480s21c1
Sequence:CCGGAGTCTCTGGCATCTCTATCCCCTCGAGGGGATAGAGATGCCAGAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c2
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021173.3-818s21c1
Sequence:CCGGAGTCAGACATGGACAGTTGATCTCGAGATCAACTGTCCATGTCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021173
POLD4 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta 4, accessory subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-220s1c1
Sequence:CCGGTGAGGCAGTTTGACCTGGCCTCTCGAGAGGCCAGGTCAAACTGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-358s1c1
Sequence:CCGGCCCGCTTCCAGTGCAGTCTCTCTCGAGAGAGACTGCACTGGAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-107s1c1
Sequence:CCGGCCCGGTTGTGAAGAGGAGGGACTCGAGTCCCTCCTCTTCACAACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c1
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-103s1c1
Sequence:CCGGCCTACCCGGTTGTGAAGAGGACTCGAGTCCTCTTCACAACCGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021173.3-480s21c1
Sequence:CCGGAGTCTCTGGCATCTCTATCCCCTCGAGGGGATAGAGATGCCAGAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c2
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021173.3-818s21c1
Sequence:CCGGAGTCAGACATGGACAGTTGATCTCGAGATCAACTGTCCATGTCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021173
POLD4 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta 4, accessory subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-220s1c1
Sequence:CCGGTGAGGCAGTTTGACCTGGCCTCTCGAGAGGCCAGGTCAAACTGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-358s1c1
Sequence:CCGGCCCGCTTCCAGTGCAGTCTCTCTCGAGAGAGACTGCACTGGAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-107s1c1
Sequence:CCGGCCCGGTTGTGAAGAGGAGGGACTCGAGTCCCTCCTCTTCACAACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c1
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-103s1c1
Sequence:CCGGCCTACCCGGTTGTGAAGAGGACTCGAGTCCTCTTCACAACCGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021173.3-480s21c1
Sequence:CCGGAGTCTCTGGCATCTCTATCCCCTCGAGGGGATAGAGATGCCAGAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021173.1-281s1c2
Sequence:CCGGCTGGTGTCGGGCCAAGCAGATCTCGAGATCTGCTTGGCCCGACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021173.3-818s21c1
Sequence:CCGGAGTCAGACATGGACAGTTGATCTCGAGATCAACTGTCCATGTCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027196
VALIDATED
POLD4 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta 4, accessory subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-399s1c1
Sequence:CCGGCCTAGAGGTGTACCAAGTGTTCTCGAGAACACTTGGTACACCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-320s1c1
Sequence:CCGGCCTGGCAGTATGGGCCTTGTACTCGAGTACAAGGCCCATACTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-556s1c1
Sequence:CCGGGCTCATTCCAACCTTGGAGAACTCGAGTTCTCCAAGGTTGGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-183s1c1
Sequence:CCGGCTCCTATCCTGTTGTGAAGAACTCGAGTTCTTCACAACAGGATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-430s1c1
Sequence:CCGGCCTGAAGACCCTCACTTCCAACTCGAGTTGGAAGTGAGGGTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027196
VALIDATED
POLD4 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta 4, accessory subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-399s1c1
Sequence:CCGGCCTAGAGGTGTACCAAGTGTTCTCGAGAACACTTGGTACACCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-320s1c1
Sequence:CCGGCCTGGCAGTATGGGCCTTGTACTCGAGTACAAGGCCCATACTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-556s1c1
Sequence:CCGGGCTCATTCCAACCTTGGAGAACTCGAGTTCTCCAAGGTTGGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-183s1c1
Sequence:CCGGCTCCTATCCTGTTGTGAAGAACTCGAGTTCTTCACAACAGGATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-430s1c1
Sequence:CCGGCCTGAAGACCCTCACTTCCAACTCGAGTTGGAAGTGAGGGTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027196
VALIDATED
POLD4 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta 4, accessory subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-399s1c1
Sequence:CCGGCCTAGAGGTGTACCAAGTGTTCTCGAGAACACTTGGTACACCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027196.1-320s1c1
Sequence:CCGGCCTGGCAGTATGGGCCTTGTACTCGAGTACAAGGCCCATACTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-556s1c1
Sequence:CCGGGCTCATTCCAACCTTGGAGAACTCGAGTTCTCCAAGGTTGGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-183s1c1
Sequence:CCGGCTCCTATCCTGTTGTGAAGAACTCGAGTTCTTCACAACAGGATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027196.1-430s1c1
Sequence:CCGGCCTGAAGACCCTCACTTCCAACTCGAGTTGGAAGTGAGGGTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)