EMAIL THIS PAGE TO A FRIEND

POLDIP2

polymerase (DNA-directed), delta interacting protein 2

121 Gene Product Result for
Synonyms: PDIP38 POLD4
UniProtKB ID: Q9Y2S7, B2R846, Q96JE4
Gene ID:
Human(26073) Summary: This gene encodes a protein that interacts with the DNA polymerase delta p50 subunit. The encoded protein also interacts with proliferating cell nuclear antigen. Some transcripts of this gene overlap in a tail-to-tail orientation with the gene for tumor necrosis factor, alpha-induced protein 1 (TNFAIP1). [provided by RefSeq, Jul 2008]
Mouse(67811) polymerase (DNA-directed), delta interacting protein 2
Rat(287544) polymerase (DNA-directed), delta interacting protein 2
Zebrafish(100000398) polymerase (DNA-directed), delta interacting protein 2
dog(491162) polymerase (DNA-directed), delta interacting protein 2
Horse(100072037) polymerase (DNA-directed), delta interacting protein 2
domestic cat(101086355) polymerase (DNA-directed), delta interacting protein 2
naked mole-rat(101704391) polymerase (DNA-directed), delta interacting protein 2
Domestic Rabbit(100348174) polymerase (DNA-directed), delta interacting protein 2
domestic guinea pig(100727945) polymerase (DNA-directed), delta interacting protein 2
cow(539673) polymerase (DNA-directed), delta interacting protein 2
sheep(101118713) polymerase (DNA-directed), delta interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015584 Rosetta Predictions human pricing
NM_001105816 Rosetta Predictions rat pricing
NM_026389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030249 predicted 695
2 SASI_Hs01_00030250 predicted 323
3 SASI_Hs02_00348169 predicted 834
4 SASI_Hs01_00030251 predicted 691
5 SASI_Hs01_00030252 predicted 1150
6 SASI_Hs01_00030253 predicted 524
7 SASI_Hs01_00030254 predicted 561
8 SASI_Hs01_00030255 predicted 1453
9 SASI_Hs01_00030256 predicted 412
10 SASI_Hs01_00030257 predicted 1291
11 SASI_Hs01_00030258 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212816 predicted 1373
2 SASI_Rn02_00212817 predicted 1439
3 SASI_Rn02_00212818 predicted 1422
4 SASI_Rn02_00212819 predicted 1534
5 SASI_Rn02_00212820 predicted 1451
6 SASI_Rn02_00212821 predicted 1428
7 SASI_Rn02_00212822 predicted 1359
8 SASI_Rn02_00212823 predicted 1369
9 SASI_Rn02_00212824 predicted 1362
10 SASI_Rn02_00212825 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085681 predicted 790
2 SASI_Mm01_00085682 predicted 204
3 SASI_Mm01_00085683 predicted 798
4 SASI_Mm01_00085684 predicted 255
5 SASI_Mm01_00085685 predicted 583
6 SASI_Mm01_00085686 predicted 406
7 SASI_Mm01_00085687 predicted 375
8 SASI_Mm01_00085688 predicted 293
9 SASI_Mm01_00085689 predicted 1175
10 SASI_Mm01_00085690 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026389
VALIDATED
POLDIP2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta interacting protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-806s21c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026389.3-1146s21c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-956s1c1
Sequence:CCGGGCATTCCAGTATAGCAGCCATCTCGAGATGGCTGCTATACTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-805s1c1
Sequence:CCGGGCGCTATTGTATACGCTTGGACTCGAGTCCAAGCGTATACAATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-806s1c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-436s21c1
Sequence:CCGGCCGTGACTGCCCACATATATCCTCGAGGATATATGTGGGCAGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-522s21c1
Sequence:CCGGCTATCCCAGGGTTGGACTATGCTCGAGCATAGTCCAACCCTGGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-1146s1c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-444s1c1
Sequence:CCGGGCCCACATATATCTCAGAGATCTCGAGATCTCTGAGATATATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026389
VALIDATED
POLDIP2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta interacting protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-806s21c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026389.3-1146s21c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-956s1c1
Sequence:CCGGGCATTCCAGTATAGCAGCCATCTCGAGATGGCTGCTATACTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-805s1c1
Sequence:CCGGGCGCTATTGTATACGCTTGGACTCGAGTCCAAGCGTATACAATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-806s1c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-436s21c1
Sequence:CCGGCCGTGACTGCCCACATATATCCTCGAGGATATATGTGGGCAGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-522s21c1
Sequence:CCGGCTATCCCAGGGTTGGACTATGCTCGAGCATAGTCCAACCCTGGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-1146s1c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-444s1c1
Sequence:CCGGGCCCACATATATCTCAGAGATCTCGAGATCTCTGAGATATATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026389
VALIDATED
POLDIP2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta interacting protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-806s21c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026389.3-1146s21c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-956s1c1
Sequence:CCGGGCATTCCAGTATAGCAGCCATCTCGAGATGGCTGCTATACTGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-805s1c1
Sequence:CCGGGCGCTATTGTATACGCTTGGACTCGAGTCCAAGCGTATACAATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-806s1c1
Sequence:CCGGCGCTATTGTATACGCTTGGAACTCGAGTTCCAAGCGTATACAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-436s21c1
Sequence:CCGGCCGTGACTGCCCACATATATCCTCGAGGATATATGTGGGCAGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026389.3-522s21c1
Sequence:CCGGCTATCCCAGGGTTGGACTATGCTCGAGCATAGTCCAACCCTGGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-1146s1c1
Sequence:CCGGCCTAAGAACAACAGCTCTCAACTCGAGTTGAGAGCTGTTGTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026389.2-444s1c1
Sequence:CCGGGCCCACATATATCTCAGAGATCTCGAGATCTCTGAGATATATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015584
VALIDATED
POLDIP2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta interacting protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-525s21c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-928s21c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-824s21c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-1155s21c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-595s21c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-558s1c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-787s1c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-1118s1c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-891s1c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-488s1c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015584
VALIDATED
POLDIP2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta interacting protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-525s21c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-928s21c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-824s21c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-1155s21c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-595s21c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-558s1c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-787s1c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-1118s1c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-891s1c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-488s1c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015584
VALIDATED
POLDIP2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta interacting protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-525s21c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-928s21c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-824s21c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-1155s21c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015584.3-595s21c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-558s1c1
Sequence:CCGGGTGACCTTCTTGGCTAACCATCTCGAGATGGTTAGCCAAGAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-787s1c1
Sequence:CCGGCCGATGTTCATCGGGAAACAACTCGAGTTGTTTCCCGATGAACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-1118s1c1
Sequence:CCGGCTCCCACTTTGATGTTCGGATCTCGAGATCCGAACATCAAAGTGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-891s1c1
Sequence:CCGGTGTATCCGTTTGGAGAACCTTCTCGAGAAGGTTCTCCAAACGGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015584.2-488s1c1
Sequence:CCGGCACTTACTATCAGGTGCTGATCTCGAGATCAGCACCTGATAGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)