EMAIL THIS PAGE TO A FRIEND

POLDIP3

polymerase (DNA-directed), delta interacting protein 3

90 Gene Product Result for
Synonyms: PDIP46 SKAR
Gene ID:
Human(84271) Summary: This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(73826) polymerase (DNA-directed), delta interacting protein 3
Rat(315170) polymerase (DNA-directed), delta interacting protein 3
cow(512693) polymerase (DNA-directed), delta interacting protein 3
sheep(101115019) polymerase (DNA-directed), delta interacting protein 3
domestic guinea pig(100720524) polymerase (DNA-directed), delta interacting protein 3
naked mole-rat(101719573) polymerase (DNA-directed), delta interacting protein 3
chicken(417974) polymerase (DNA-directed), delta interacting protein 3
dog(474480) polymerase (DNA-directed), delta interacting protein 3
Horse(100071034) polymerase (DNA-directed), delta interacting protein 3
domestic cat(101085300) polymerase (DNA-directed), delta interacting protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032311 Rosetta Predictions human pricing
NM_178136 Rosetta Predictions human pricing
NM_001130506 Rosetta Predictions rat pricing
NM_178627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114369 predicted 1558
2 SASI_Hs01_00114370 predicted 1472
3 SASI_Hs01_00114371 predicted 1658
4 SASI_Hs01_00114372 predicted 1591
5 SASI_Hs01_00114373 predicted 1135
6 SASI_Hs01_00114375 predicted 1083
7 SASI_Hs02_00359658 predicted 1642
8 SASI_Hs01_00114376 predicted 1666
9 SASI_Hs01_00114377 predicted 933
10 SASI_Hs01_00114378 predicted 964
11 SASI_Hs01_00114374 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101126 predicted 1474
2 SASI_Hs01_00101127 predicted 1379
3 SASI_Hs01_00101128 predicted 1564
4 SASI_Hs01_00101129 predicted 1499
5 SASI_Hs01_00101130 predicted 1053
6 SASI_Hs01_00101132 predicted 997
7 SASI_Hs02_00369543 predicted 1555
8 SASI_Hs01_00101133 predicted 1584
9 SASI_Hs01_00101134 predicted 844
10 SASI_Hs01_00101135 predicted 880
11 SASI_Hs01_00101131 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255489 predicted 1499
2 SASI_Rn02_00255490 predicted 925
3 SASI_Rn02_00255491 predicted 1119
4 SASI_Rn02_00255492 predicted 676
5 SASI_Rn02_00255493 predicted 822
6 SASI_Rn02_00255494 predicted 926
7 SASI_Rn02_00255495 predicted 243
8 SASI_Rn02_00255496 predicted 202
9 SASI_Rn02_00255497 predicted 593
10 SASI_Rn02_00255498 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114734 predicted 1023
2 SASI_Mm01_00114735 predicted 1435
3 SASI_Mm01_00114736 predicted 707
4 SASI_Mm01_00114737 predicted 431
5 SASI_Mm01_00114738 predicted 913
6 SASI_Mm01_00114739 predicted 338
7 SASI_Mm01_00114740 predicted 237
8 SASI_Mm02_00348989 predicted 1067
9 SASI_Mm01_00114741 predicted 1110
10 SASI_Mm01_00114742 predicted 606
11 SASI_Mm01_00114743 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032311
VALIDATED
POLDIP3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta interacting protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-624s21c1
Sequence:CCGGCCAGGCCAAACAGAATTTATACTCGAGTATAAATTCTGTTTGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1542s21c1
Sequence:CCGGGTGCTCTTCTCTCTACGTTAACTCGAGTTAACGTAGAGAGAAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-822s21c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-653s21c1
Sequence:CCGGATGAAGATGATGATGGTATAGCTCGAGCTATACCATCATCATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-334s21c1
Sequence:CCGGTTGCAGAAAGATGCCCGATTTCTCGAGAAATCGGGCATCTTTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1073s21c1
Sequence:CCGGACGATGCCATCACCGCATATACTCGAGTATATGCGGTGATGGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-1086s1c1
Sequence:CCGGCGCATATAAGAAGTACAACAACTCGAGTTGTTGTACTTCTTATATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-487s1c1
Sequence:CCGGGCCTTCATAAACCCACCCATTCTCGAGAATGGGTGGGTTTATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-822s1c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-592s1c1
Sequence:CCGGGCCGGAATGAGAATCAATGTTCTCGAGAACATTGATTCTCATTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-682s1c1
Sequence:CCGGCCTACTAAACAGATGAAGTTTCTCGAGAAACTTCATCTGTTTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032311
VALIDATED
POLDIP3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta interacting protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-624s21c1
Sequence:CCGGCCAGGCCAAACAGAATTTATACTCGAGTATAAATTCTGTTTGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1542s21c1
Sequence:CCGGGTGCTCTTCTCTCTACGTTAACTCGAGTTAACGTAGAGAGAAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-822s21c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-653s21c1
Sequence:CCGGATGAAGATGATGATGGTATAGCTCGAGCTATACCATCATCATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-334s21c1
Sequence:CCGGTTGCAGAAAGATGCCCGATTTCTCGAGAAATCGGGCATCTTTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1073s21c1
Sequence:CCGGACGATGCCATCACCGCATATACTCGAGTATATGCGGTGATGGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-1086s1c1
Sequence:CCGGCGCATATAAGAAGTACAACAACTCGAGTTGTTGTACTTCTTATATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-487s1c1
Sequence:CCGGGCCTTCATAAACCCACCCATTCTCGAGAATGGGTGGGTTTATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-822s1c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-592s1c1
Sequence:CCGGGCCGGAATGAGAATCAATGTTCTCGAGAACATTGATTCTCATTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-682s1c1
Sequence:CCGGCCTACTAAACAGATGAAGTTTCTCGAGAAACTTCATCTGTTTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032311
VALIDATED
POLDIP3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta interacting protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-624s21c1
Sequence:CCGGCCAGGCCAAACAGAATTTATACTCGAGTATAAATTCTGTTTGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1542s21c1
Sequence:CCGGGTGCTCTTCTCTCTACGTTAACTCGAGTTAACGTAGAGAGAAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032311.3-822s21c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-653s21c1
Sequence:CCGGATGAAGATGATGATGGTATAGCTCGAGCTATACCATCATCATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-334s21c1
Sequence:CCGGTTGCAGAAAGATGCCCGATTTCTCGAGAAATCGGGCATCTTTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_032311.3-1073s21c1
Sequence:CCGGACGATGCCATCACCGCATATACTCGAGTATATGCGGTGATGGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-1086s1c1
Sequence:CCGGCGCATATAAGAAGTACAACAACTCGAGTTGTTGTACTTCTTATATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-487s1c1
Sequence:CCGGGCCTTCATAAACCCACCCATTCTCGAGAATGGGTGGGTTTATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-822s1c1
Sequence:CCGGCCCTTCCTCTATTCGAACAAACTCGAGTTTGTTCGAATAGAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032311.3-592s1c1
Sequence:CCGGGCCGGAATGAGAATCAATGTTCTCGAGAACATTGATTCTCATTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032311.3-682s1c1
Sequence:CCGGCCTACTAAACAGATGAAGTTTCTCGAGAAACTTCATCTGTTTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178627
VALIDATED
POLDIP3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), delta interacting protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-1103s21c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178627.3-1488s21c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-608s21c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-333s21c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1489s1c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1108s1c1
Sequence:CCGGCAACCTATGAAGTGCAACCTTCTCGAGAAGGTTGCACTTCATAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1104s1c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-334s1c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-609s1c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178627
VALIDATED
POLDIP3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), delta interacting protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-1103s21c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178627.3-1488s21c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-608s21c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-333s21c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1489s1c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1108s1c1
Sequence:CCGGCAACCTATGAAGTGCAACCTTCTCGAGAAGGTTGCACTTCATAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1104s1c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-334s1c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-609s1c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178627
VALIDATED
POLDIP3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), delta interacting protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-1103s21c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178627.3-1488s21c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-608s21c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178627.3-333s21c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1489s1c1
Sequence:CCGGCCCACCTTTCTGTGTTGTTTACTCGAGTAAACAACACAGAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1108s1c1
Sequence:CCGGCAACCTATGAAGTGCAACCTTCTCGAGAAGGTTGCACTTCATAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-1104s1c1
Sequence:CCGGTGGGCAACCTATGAAGTGCAACTCGAGTTGCACTTCATAGGTTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-334s1c1
Sequence:CCGGCGGTTTCGGATCAAAGGGAAACTCGAGTTTCCCTTTGATCCGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178627.1-609s1c1
Sequence:CCGGCCAGGCTAAACAGAACTTGTACTCGAGTACAAGTTCTGTTTAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)