EMAIL THIS PAGE TO A FRIEND

POLE2

polymerase (DNA directed), epsilon 2, accessory subunit

62 Gene Product Result for
Synonyms: DPE2
Gene ID:
Mouse(18974) polymerase (DNA directed), epsilon 2 (p59 subunit)
Rat(299112) polymerase (DNA directed), epsilon 2, accessory subunit
fruit fly(38661) CG10489 gene product from transcript CG10489-RA
Zebrafish(192320) polymerase (DNA directed), epsilon 2
chicken(423567) polymerase (DNA directed), epsilon 2, accessory subunit
dog(608973) polymerase (DNA directed), epsilon 2, accessory subunit
domestic cat(101092770) polymerase (DNA directed), epsilon 2, accessory subunit
cow(518653) polymerase (DNA directed), epsilon 2 (p59 subunit)
sheep(101123044) polymerase (DNA directed), epsilon 2, accessory subunit
domestic guinea pig(100725125) polymerase (DNA directed), epsilon 2, accessory subunit
naked mole-rat(101705066) polymerase (DNA directed), epsilon 2, accessory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027555 Anti-POLE2 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0005427M1 Monoclonal Anti-POLE2 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002692 Rosetta Predictions human pricing
XM_001076651 Rosetta Predictions rat pricing
XM_216727 Rosetta Predictions rat pricing
NM_011133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215257 predicted 640
2 SASI_Hs01_00215258 predicted 516
3 SASI_Hs01_00215260 predicted 926
4 SASI_Hs01_00215261 predicted 750
5 SASI_Hs02_00334261 predicted 1387
6 SASI_Hs01_00215262 predicted 283
7 SASI_Hs01_00215264 predicted 1310
8 SASI_Hs01_00215265 predicted 707
9 SASI_Hs01_00215266 predicted 548
10 SASI_Hs02_00334262 predicted 1318
11 SASI_Hs01_00215259 predicted 1390
12 SASI_Hs01_00215263 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354012 predicted 1065
2 SASI_Rn02_00354013 predicted 819
3 SASI_Rn02_00354014 predicted 251
4 SASI_Rn02_00354015 predicted 1160
5 SASI_Rn02_00354016 predicted 258
6 SASI_Rn02_00354017 predicted 882
7 SASI_Rn02_00354018 predicted 567
8 SASI_Rn02_00354019 predicted 713
9 SASI_Rn02_00354020 predicted 1081
10 SASI_Rn02_00354021 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376787 predicted 1265
2 SASI_Rn02_00376788 predicted 1304
3 SASI_Rn02_00376789 predicted 1228
4 SASI_Rn02_00376790 predicted 1263
5 SASI_Rn02_00376791 predicted 1166
6 SASI_Rn02_00376792 predicted 1164
7 SASI_Rn02_00376793 predicted 1311
8 SASI_Rn02_00376794 predicted 1409
9 SASI_Rn02_00376795 predicted 1449
10 SASI_Rn02_00376796 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174578 predicted 712
2 SASI_Mm01_00174579 predicted 251
3 SASI_Mm01_00174580 predicted 406
4 SASI_Mm01_00174581 predicted 1349
5 SASI_Mm02_00319960 predicted 830
6 SASI_Mm01_00174583 predicted 1060
7 SASI_Mm01_00174584 predicted 827
8 SASI_Mm01_00174585 predicted 1186
9 SASI_Mm01_00174586 predicted 470
10 SASI_Mm01_00174587 predicted 1222
11 SASI_Mm01_00174582 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011133
POLE2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon 2, accessory subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-410s1c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-100s1c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-349s1c1
Sequence:CCGGCCTCTATCCATGACTAATCATCTCGAGATGATTAGTCATGGATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1272s1c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1271s21c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1458s1c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1457s21c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-99s21c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-409s21c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011133
POLE2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon 2, accessory subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-410s1c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-100s1c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-349s1c1
Sequence:CCGGCCTCTATCCATGACTAATCATCTCGAGATGATTAGTCATGGATAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1272s1c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1271s21c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1458s1c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1457s21c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-99s21c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-409s21c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011133
POLE2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon 2, accessory subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-410s1c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-100s1c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-349s1c1
Sequence:CCGGCCTCTATCCATGACTAATCATCTCGAGATGATTAGTCATGGATAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1272s1c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1271s21c1
Sequence:CCGGCCGTGAAGACTTAGTGAATAACTCGAGTTATTCACTAAGTCTTCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011133.1-1458s1c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-1457s21c1
Sequence:CCGGGCTGGTCATTGCAGACAAGTACTCGAGTACTTGTCTGCAATGACCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-99s21c1
Sequence:CCGGGCCACCAAGTATCTGACTGAACTCGAGTTCAGTCAGATACTTGGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011133.2-409s21c1
Sequence:CCGGAGCTGTATCTTGAACGCTATACTCGAGTATAGCGTTCAAGATACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002692
VALIDATED
POLE2 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon 2, accessory subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-1258s21c1
Sequence:CCGGTCCGTGAAGACTTAGTAAATACTCGAGTATTTACTAAGTCTTCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-397s21c1
Sequence:CCGGAGATGTTTCGTGAGCGATATACTCGAGTATATCGCTCACGAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-87s1c1
Sequence:CCGGGCTATTAAGTACCTCACAGAACTCGAGTTCTGTGAGGTACTTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-927s1c1
Sequence:CCGGCGCATAATGTTTGCTGGTTATCTCGAGATAACCAGCAAACATTATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-555s1c1
Sequence:CCGGGCGATTGTTCTTGGAATGATACTCGAGTATCATTCCAAGAACAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-1259s1c1
Sequence:CCGGCCGTGAAGACTTAGTAAATAACTCGAGTTATTTACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-285s1c1
Sequence:CCGGGCATTTGATATTCCACGCTTTCTCGAGAAAGCGTGGAATATCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-624s21c1
Sequence:CCGGGTCCAACTAGACCTTAGTAAACTCGAGTTTACTAAGGTCTAGTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-565s21c1
Sequence:CCGGTTGGAATGATAACGCAGTTAACTCGAGTTAACTGCGTTATCATTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-74s21c1
Sequence:CCGGGCTCCGTGGTGAAGCTATTAACTCGAGTTAATAGCTTCACCACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002692
VALIDATED
POLE2 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon 2, accessory subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-1258s21c1
Sequence:CCGGTCCGTGAAGACTTAGTAAATACTCGAGTATTTACTAAGTCTTCACGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-397s21c1
Sequence:CCGGAGATGTTTCGTGAGCGATATACTCGAGTATATCGCTCACGAAACATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-87s1c1
Sequence:CCGGGCTATTAAGTACCTCACAGAACTCGAGTTCTGTGAGGTACTTAATAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-927s1c1
Sequence:CCGGCGCATAATGTTTGCTGGTTATCTCGAGATAACCAGCAAACATTATGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-555s1c1
Sequence:CCGGGCGATTGTTCTTGGAATGATACTCGAGTATCATTCCAAGAACAATCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-1259s1c1
Sequence:CCGGCCGTGAAGACTTAGTAAATAACTCGAGTTATTTACTAAGTCTTCACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-285s1c1
Sequence:CCGGGCATTTGATATTCCACGCTTTCTCGAGAAAGCGTGGAATATCAAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-624s21c1
Sequence:CCGGGTCCAACTAGACCTTAGTAAACTCGAGTTTACTAAGGTCTAGTTGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-565s21c1
Sequence:CCGGTTGGAATGATAACGCAGTTAACTCGAGTTAACTGCGTTATCATTCCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000233180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-74s21c1
Sequence:CCGGGCTCCGTGGTGAAGCTATTAACTCGAGTTAATAGCTTCACCACGGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002692
VALIDATED
POLE2 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon 2, accessory subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-1258s21c1
Sequence:CCGGTCCGTGAAGACTTAGTAAATACTCGAGTATTTACTAAGTCTTCACGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000233181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-397s21c1
Sequence:CCGGAGATGTTTCGTGAGCGATATACTCGAGTATATCGCTCACGAAACATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-87s1c1
Sequence:CCGGGCTATTAAGTACCTCACAGAACTCGAGTTCTGTGAGGTACTTAATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-927s1c1
Sequence:CCGGCGCATAATGTTTGCTGGTTATCTCGAGATAACCAGCAAACATTATGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-555s1c1
Sequence:CCGGGCGATTGTTCTTGGAATGATACTCGAGTATCATTCCAAGAACAATCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002692.2-1259s1c1
Sequence:CCGGCCGTGAAGACTTAGTAAATAACTCGAGTTATTTACTAAGTCTTCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002692.2-285s1c1
Sequence:CCGGGCATTTGATATTCCACGCTTTCTCGAGAAAGCGTGGAATATCAAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000233183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-624s21c1
Sequence:CCGGGTCCAACTAGACCTTAGTAAACTCGAGTTTACTAAGGTCTAGTTGGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000233182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-565s21c1
Sequence:CCGGTTGGAATGATAACGCAGTTAACTCGAGTTAACTGCGTTATCATTCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000233180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002692.2-74s21c1
Sequence:CCGGGCTCCGTGGTGAAGCTATTAACTCGAGTTAATAGCTTCACCACGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???