EMAIL THIS PAGE TO A FRIEND

POLE3

polymerase (DNA directed), epsilon 3, accessory subunit

164 Gene Product Result for
Synonyms: CHARAC17 CHRAC17 YBL1 p17
UniProtKB ID: Q9NRF9, Q5W0U1, Q8N758, Q8NCE5, Q9NR32
Gene ID:
Human(54107) Summary: POLE3 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]
Mouse(59001) polymerase (DNA directed), epsilon 3 (p17 subunit)
Rat(298098) polymerase (DNA directed), epsilon 3, accessory subunit
naked mole-rat(101701491) polymerase (DNA directed), epsilon 3, accessory subunit
domestic guinea pig(100733855) polymerase (DNA directed), epsilon 3, accessory subunit
cow(510678) polymerase (DNA directed), epsilon 3 (p17 subunit)
sheep(101106138) polymerase (DNA directed), epsilon 3, accessory subunit
Zebrafish(393774) polymerase (DNA directed), epsilon 3 (p17 subunit)
chicken(417275) polymerase (DNA directed), epsilon 3, accessory subunit
domestic cat(101097106) polymerase (DNA directed), epsilon 3, accessory subunit
dog(612550) polymerase (DNA directed), epsilon 3, accessory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017443 Rosetta Predictions human pricing
NM_001007652 Rosetta Predictions rat pricing
NM_021498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047275 predicted 207
2 SASI_Hs01_00047276 predicted 1072
3 SASI_Hs01_00047278 predicted 1090
4 SASI_Hs01_00047279 predicted 245
5 SASI_Hs01_00047284 predicted 1083
6 SASI_Hs01_00047281 predicted 1054
7 SASI_Hs01_00047282 predicted 1056
8 SASI_Hs02_00350047 predicted 1049
9 SASI_Hs02_00350048 predicted 1042
10 SASI_Hs01_00047283 predicted 1060
11 SASI_Hs01_00047277 predicted 866
12 SASI_Hs01_00047280 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122227 predicted 712
2 SASI_Rn01_00122228 predicted 873
3 SASI_Rn01_00122229 predicted 661
4 SASI_Rn01_00122230 predicted 854
5 SASI_Rn01_00122231 predicted 723
6 SASI_Rn01_00122232 predicted 661
7 SASI_Rn01_00122233 predicted 877
8 SASI_Rn01_00122234 predicted 251
9 SASI_Rn01_00122235 predicted 670
10 SASI_Rn01_00122236 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077825 predicted 165
2 SASI_Mm01_00077826 predicted 49
3 SASI_Mm01_00077827 predicted 161
4 SASI_Mm02_00326200 predicted 255
5 SASI_Mm01_00077828 predicted 191
6 SASI_Mm01_00077829 predicted 238
7 SASI_Mm01_00077831 predicted 202
8 SASI_Mm01_00077832 predicted 237
9 SASI_Mm01_00077833 predicted 551
10 SASI_Mm01_00077834 predicted 184
11 SASI_Mm01_00077830 predicted 174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021498
VALIDATED
POLE3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon 3, accessory subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-194s21c1
Sequence:CCGGGAAAGCGCAAGACTCTCAATGCTCGAGCATTGAGAGTCTTGCGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-255s21c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-57s21c1
Sequence:CCGGCGTCATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-169s21c1
Sequence:CCGGTGTGCCAATAACTTCGCAATGCTCGAGCATTGCGAAGTTATTGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-91s21c1
Sequence:CCGGGACGGTGTCAACATCTCCAAGCTCGAGCTTGGAGATGTTGACACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021498.2-183s1c1
Sequence:CCGGCGCAATGAAAGGAAAGCGCAACTCGAGTTGCGCTTTCCTTTCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-256s1c1
Sequence:CCGGCGATTCATAACACCATTGAAACTCGAGTTTCAATGGTGTTATGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-255s1c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-172s1c1
Sequence:CCGGGCCAATAACTTCGCAATGAAACTCGAGTTTCATTGCGAAGTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-252s1c1
Sequence:CCGGCCAGCGATTCATAACACCATTCTCGAGAATGGTGTTATGAATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021498
VALIDATED
POLE3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon 3, accessory subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-194s21c1
Sequence:CCGGGAAAGCGCAAGACTCTCAATGCTCGAGCATTGAGAGTCTTGCGCTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000311779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-255s21c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-57s21c1
Sequence:CCGGCGTCATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-169s21c1
Sequence:CCGGTGTGCCAATAACTTCGCAATGCTCGAGCATTGCGAAGTTATTGGCACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000312770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-91s21c1
Sequence:CCGGGACGGTGTCAACATCTCCAAGCTCGAGCTTGGAGATGTTGACACCGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021498.2-183s1c1
Sequence:CCGGCGCAATGAAAGGAAAGCGCAACTCGAGTTGCGCTTTCCTTTCATTGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-256s1c1
Sequence:CCGGCGATTCATAACACCATTGAAACTCGAGTTTCAATGGTGTTATGAATCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-255s1c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-172s1c1
Sequence:CCGGGCCAATAACTTCGCAATGAAACTCGAGTTTCATTGCGAAGTTATTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-252s1c1
Sequence:CCGGCCAGCGATTCATAACACCATTCTCGAGAATGGTGTTATGAATCGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021498
VALIDATED
POLE3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon 3, accessory subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-194s21c1
Sequence:CCGGGAAAGCGCAAGACTCTCAATGCTCGAGCATTGAGAGTCTTGCGCTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-255s21c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-57s21c1
Sequence:CCGGCGTCATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-169s21c1
Sequence:CCGGTGTGCCAATAACTTCGCAATGCTCGAGCATTGCGAAGTTATTGGCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021498.2-91s21c1
Sequence:CCGGGACGGTGTCAACATCTCCAAGCTCGAGCTTGGAGATGTTGACACCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021498.2-183s1c1
Sequence:CCGGCGCAATGAAAGGAAAGCGCAACTCGAGTTGCGCTTTCCTTTCATTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-256s1c1
Sequence:CCGGCGATTCATAACACCATTGAAACTCGAGTTTCAATGGTGTTATGAATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-255s1c1
Sequence:CCGGGCGATTCATAACACCATTGAACTCGAGTTCAATGGTGTTATGAATCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-172s1c1
Sequence:CCGGGCCAATAACTTCGCAATGAAACTCGAGTTTCATTGCGAAGTTATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000082259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021498.2-252s1c1
Sequence:CCGGCCAGCGATTCATAACACCATTCTCGAGAATGGTGTTATGAATCGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017443
VALIDATED
POLE3 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon 3, accessory subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-405s1c1
Sequence:CCGGCCAGCGGTTCGTTATCCCATTCTCGAGAATGGGATAACGAACCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017443.3-815s1c1
Sequence:CCGGGCTTCATCAATCTGAAGGTTACTCGAGTAACCTTCAGATTGATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-320s1c1
Sequence:CCGGCCTGTGCTAACAACTTTGCAACTCGAGTTGCAAAGTTGTTAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-210s1c1
Sequence:CCGGCGTGATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-409s1c1
Sequence:CCGGCGGTTCGTTATCCCATTGAAACTCGAGTTTCAATGGGATAACGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017443
VALIDATED
POLE3 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon 3, accessory subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-405s1c1
Sequence:CCGGCCAGCGGTTCGTTATCCCATTCTCGAGAATGGGATAACGAACCGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017443.3-815s1c1
Sequence:CCGGGCTTCATCAATCTGAAGGTTACTCGAGTAACCTTCAGATTGATGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-320s1c1
Sequence:CCGGCCTGTGCTAACAACTTTGCAACTCGAGTTGCAAAGTTGTTAGCACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-210s1c1
Sequence:CCGGCGTGATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000107456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-409s1c1
Sequence:CCGGCGGTTCGTTATCCCATTGAAACTCGAGTTTCAATGGGATAACGAACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017443
VALIDATED
POLE3 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon 3, accessory subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-405s1c1
Sequence:CCGGCCAGCGGTTCGTTATCCCATTCTCGAGAATGGGATAACGAACCGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000107455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017443.3-815s1c1
Sequence:CCGGGCTTCATCAATCTGAAGGTTACTCGAGTAACCTTCAGATTGATGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000107459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-320s1c1
Sequence:CCGGCCTGTGCTAACAACTTTGCAACTCGAGTTGCAAAGTTGTTAGCACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000107457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017443.3-210s1c1
Sequence:CCGGCGTGATCACCAGGATCATCAACTCGAGTTGATGATCCTGGTGATCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000107456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017443.3-409s1c1
Sequence:CCGGCGGTTCGTTATCCCATTGAAACTCGAGTTTCAATGGGATAACGAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???