EMAIL THIS PAGE TO A FRIEND

POLE4

polymerase (DNA-directed), epsilon 4, accessory subunit

97 Gene Product Result for
Synonyms: YHHQ1 p12
UniProtKB ID: Q9NR33, Q53TR2
Gene ID:
Human(56655) Summary: POLE4 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging.[supplied by OMIM, Apr 2004]
Mouse(66979) polymerase (DNA-directed), epsilon 4 (p12 subunit)
Rat(362385) polymerase (DNA-directed), epsilon 4, accessory subunit
Horse(100068933) polymerase (DNA-directed), epsilon 4, accessory subunit
domestic cat(101089849) polymerase (DNA-directed), epsilon 4, accessory subunit
dog(483096) polymerase (DNA-directed), epsilon 4, accessory subunit
cow(613730) polymerase (DNA-directed), epsilon 4 (p12 subunit)
sheep(101107950) polymerase (DNA-directed), epsilon 4, accessory subunit
domestic guinea pig(100735273) polymerase (DNA-directed), epsilon 4, accessory subunit
naked mole-rat(101721926) polymerase (DNA-directed), epsilon 4, accessory subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019896 Rosetta Predictions human pricing
NM_001108634 Rosetta Predictions rat pricing
NM_025882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053119 predicted 275
2 SASI_Hs01_00053120 predicted 363
3 SASI_Hs01_00053121 predicted 231
4 SASI_Hs02_00352919 predicted 305
5 SASI_Hs02_00352920 predicted 344
6 SASI_Hs02_00352921 predicted 434
7 SASI_Hs01_00053125 predicted 269
8 SASI_Hs02_00352922 predicted 401
9 SASI_Hs01_00053126 predicted 231
10 SASI_Hs01_00053127 predicted 457
11 SASI_Hs01_00053118 predicted 331
12 SASI_Hs01_00053122 predicted 464
13 SASI_Hs01_00053123 predicted 324
14 SASI_Hs01_00053124 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240559 predicted 596
2 SASI_Rn02_00240560 predicted 639
3 SASI_Rn02_00240561 predicted 660
4 SASI_Rn02_00240562 predicted 374
5 SASI_Rn02_00240563 predicted 648
6 SASI_Rn02_00240564 predicted 504
7 SASI_Rn02_00240565 predicted 400
8 SASI_Rn02_00240566 predicted 554
9 SASI_Rn02_00240567 predicted 492
10 SASI_Rn02_00240568 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027393 predicted 806
2 SASI_Mm01_00027394 predicted 621
3 SASI_Mm01_00027395 predicted 630
4 SASI_Mm01_00027396 predicted 442
5 SASI_Mm01_00027397 predicted 309
6 SASI_Mm01_00027398 predicted 810
7 SASI_Mm01_00027399 predicted 831
8 SASI_Mm01_00027400 predicted 315
9 SASI_Mm01_00027401 predicted 463
10 SASI_Mm01_00027402 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019896
VALIDATED
POLE4 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), epsilon 4, accessory subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-456s21c1
Sequence:CCGGCTTTGAAGAACGGAGTCTTTGCTCGAGCAAAGACTCCGTTCTTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-272s21c1
Sequence:CCGGAGATGCCTACTGTTGCGCTCACTCGAGTGAGCGCAACAGTAGGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-506s21c1
Sequence:CCGGTCACCTATGCCGGGATAAGCACTCGAGTGCTTATCCCGGCATAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-369s21c1
Sequence:CCGGGAAGGTACTTTAGATTGATTGCTCGAGCAATCAATCTAAAGTACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-528s21c1
Sequence:CCGGAGATCTCATCAATTAGCTCTTCTCGAGAAGAGCTAATTGATGAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-324s1c1
Sequence:CCGGGACTTGGATAATGCAATAGAACTCGAGTTCTATTGCATTATCCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-246s1c1
Sequence:CCGGGAACTGTTTGTGGAGACCATTCTCGAGAATGGTCTCCACAAACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-164s1c1
Sequence:CCGGGCGAGTGAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTCACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019896.2-344s1c1
Sequence:CCGGAGCTGTGGATGAATTTGCTTTCTCGAGAAAGCAAATTCATCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-216s1c1
Sequence:CCGGGAAGCCATCTTCATTCTGGCACTCGAGTGCCAGAATGAAGATGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019896
VALIDATED
POLE4 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), epsilon 4, accessory subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-456s21c1
Sequence:CCGGCTTTGAAGAACGGAGTCTTTGCTCGAGCAAAGACTCCGTTCTTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-272s21c1
Sequence:CCGGAGATGCCTACTGTTGCGCTCACTCGAGTGAGCGCAACAGTAGGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-506s21c1
Sequence:CCGGTCACCTATGCCGGGATAAGCACTCGAGTGCTTATCCCGGCATAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-369s21c1
Sequence:CCGGGAAGGTACTTTAGATTGATTGCTCGAGCAATCAATCTAAAGTACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-528s21c1
Sequence:CCGGAGATCTCATCAATTAGCTCTTCTCGAGAAGAGCTAATTGATGAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-324s1c1
Sequence:CCGGGACTTGGATAATGCAATAGAACTCGAGTTCTATTGCATTATCCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-246s1c1
Sequence:CCGGGAACTGTTTGTGGAGACCATTCTCGAGAATGGTCTCCACAAACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-164s1c1
Sequence:CCGGGCGAGTGAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTCACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019896.2-344s1c1
Sequence:CCGGAGCTGTGGATGAATTTGCTTTCTCGAGAAAGCAAATTCATCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-216s1c1
Sequence:CCGGGAAGCCATCTTCATTCTGGCACTCGAGTGCCAGAATGAAGATGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019896
VALIDATED
POLE4 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), epsilon 4, accessory subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-456s21c1
Sequence:CCGGCTTTGAAGAACGGAGTCTTTGCTCGAGCAAAGACTCCGTTCTTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-272s21c1
Sequence:CCGGAGATGCCTACTGTTGCGCTCACTCGAGTGAGCGCAACAGTAGGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-506s21c1
Sequence:CCGGTCACCTATGCCGGGATAAGCACTCGAGTGCTTATCCCGGCATAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019896.2-369s21c1
Sequence:CCGGGAAGGTACTTTAGATTGATTGCTCGAGCAATCAATCTAAAGTACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019896.2-528s21c1
Sequence:CCGGAGATCTCATCAATTAGCTCTTCTCGAGAAGAGCTAATTGATGAGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-324s1c1
Sequence:CCGGGACTTGGATAATGCAATAGAACTCGAGTTCTATTGCATTATCCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-246s1c1
Sequence:CCGGGAACTGTTTGTGGAGACCATTCTCGAGAATGGTCTCCACAAACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-164s1c1
Sequence:CCGGGCGAGTGAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTCACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019896.2-344s1c1
Sequence:CCGGAGCTGTGGATGAATTTGCTTTCTCGAGAAAGCAAATTCATCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_019896.2-216s1c1
Sequence:CCGGGAAGCCATCTTCATTCTGGCACTCGAGTGCCAGAATGAAGATGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025882
POLE4 MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA-directed), epsilon 4, accessory subunit
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-812s21c1
Sequence:CCGGTTGGAATGTGGATCGATAATACTCGAGTATTATCGATCCACATTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-206s21c1
Sequence:CCGGGGGACAGGAAGCCATCTTTATCTCGAGATAAAGATGGCTTCCTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-365s21c1
Sequence:CCGGAGAAGGCACTTTGGATTAATTCTCGAGAATTAATCCAAAGTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-285s21c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-248s21c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-637s21c1
Sequence:CCGGATGAGCACAGACTAGAATAAACTCGAGTTTATTCTAGTCTGTGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-311s21c1
Sequence:CCGGCCAGAGGAGAGATTTGGATAACTCGAGTTATCCAAATCTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025882.1-736s1c1
Sequence:CCGGGCACAGACTTTCCTCATCTTTCTCGAGAAAGATGAGGAAAGTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-249s1c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-162s1c1
Sequence:CCGGGAGAGTAAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-334s1c1
Sequence:CCGGGCAATAGAAGCTGTGGATGAACTCGAGTTCATCCACAGCTTCTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-286s1c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025882
POLE4 MISSION shRNA shRNA Plasmid DNA
polymerase (DNA-directed), epsilon 4, accessory subunit
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-812s21c1
Sequence:CCGGTTGGAATGTGGATCGATAATACTCGAGTATTATCGATCCACATTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-206s21c1
Sequence:CCGGGGGACAGGAAGCCATCTTTATCTCGAGATAAAGATGGCTTCCTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-365s21c1
Sequence:CCGGAGAAGGCACTTTGGATTAATTCTCGAGAATTAATCCAAAGTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-285s21c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-248s21c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-637s21c1
Sequence:CCGGATGAGCACAGACTAGAATAAACTCGAGTTTATTCTAGTCTGTGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-311s21c1
Sequence:CCGGCCAGAGGAGAGATTTGGATAACTCGAGTTATCCAAATCTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025882.1-736s1c1
Sequence:CCGGGCACAGACTTTCCTCATCTTTCTCGAGAAAGATGAGGAAAGTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-249s1c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-162s1c1
Sequence:CCGGGAGAGTAAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-334s1c1
Sequence:CCGGGCAATAGAAGCTGTGGATGAACTCGAGTTCATCCACAGCTTCTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-286s1c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025882
POLE4 MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA-directed), epsilon 4, accessory subunit
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-812s21c1
Sequence:CCGGTTGGAATGTGGATCGATAATACTCGAGTATTATCGATCCACATTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-206s21c1
Sequence:CCGGGGGACAGGAAGCCATCTTTATCTCGAGATAAAGATGGCTTCCTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-365s21c1
Sequence:CCGGAGAAGGCACTTTGGATTAATTCTCGAGAATTAATCCAAAGTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-285s21c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-248s21c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025882.3-637s21c1
Sequence:CCGGATGAGCACAGACTAGAATAAACTCGAGTTTATTCTAGTCTGTGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025882.3-311s21c1
Sequence:CCGGCCAGAGGAGAGATTTGGATAACTCGAGTTATCCAAATCTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025882.1-736s1c1
Sequence:CCGGGCACAGACTTTCCTCATCTTTCTCGAGAAAGATGAGGAAAGTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-249s1c1
Sequence:CCGGGTTCGTGGAGACTATCGCAAACTCGAGTTTGCGATAGTCTCCACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-162s1c1
Sequence:CCGGGAGAGTAAAGGCCTTGGTGAACTCGAGTTCACCAAGGCCTTTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-334s1c1
Sequence:CCGGGCAATAGAAGCTGTGGATGAACTCGAGTTCATCCACAGCTTCTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025882.1-286s1c1
Sequence:CCGGGCTCAACAAGGAAAGAGGAAACTCGAGTTTCCTCTTTCCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)