EMAIL THIS PAGE TO A FRIEND

POLE

polymerase (DNA directed), epsilon, catalytic subunit

58 Gene Product Result for
Synonyms: CRCS12 FILS POLE1
UniProtKB ID: Q07864, Q13533, Q86VH9
Gene ID:
Mouse(18973) polymerase (DNA directed), epsilon
Rat(304573) polymerase (DNA directed), epsilon, catalytic subunit
Zebrafish(553405) polymerase (DNA directed), epsilon
chicken(416997) polymerase (DNA directed), epsilon, catalytic subunit
domestic cat(101096921) polymerase (DNA directed), epsilon, catalytic subunit
dog(486223) polymerase (DNA directed), epsilon, catalytic subunit
naked mole-rat(101720520) polymerase (DNA directed), epsilon, catalytic subunit
Domestic Rabbit(100338950) polymerase (DNA directed), epsilon, catalytic subunit
cow(785457) polymerase (DNA directed), epsilon, catalytic subunit
sheep(101116176) polymerase (DNA directed), epsilon, catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006231 Rosetta Predictions human pricing
NM_001107152 Rosetta Predictions rat pricing
NM_011132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115345 predicted 1403
2 SASI_Hs01_00115346 predicted 5455
3 SASI_Hs02_00341146 predicted 404
4 SASI_Hs01_00115347 predicted 4481
5 SASI_Hs01_00115348 predicted 4176
6 SASI_Hs01_00115349 predicted 1703
7 SASI_Hs01_00115350 predicted 4219
8 SASI_Hs01_00115352 predicted 343
9 SASI_Hs01_00115353 predicted 5196
10 SASI_Hs01_00115354 predicted 4299
11 SASI_Hs01_00115351 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226015 predicted 2212
2 SASI_Rn02_00226016 predicted 2612
3 SASI_Rn02_00226017 predicted 5457
4 SASI_Rn02_00226018 predicted 3054
5 SASI_Rn02_00226019 predicted 4098
6 SASI_Rn02_00226020 predicted 1906
7 SASI_Rn02_00226021 predicted 3565
8 SASI_Rn02_00226022 predicted 3534
9 SASI_Rn02_00226023 predicted 3253
10 SASI_Rn02_00226024 predicted 2829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111964 predicted 6838
2 SASI_Mm01_00111965 predicted 3088
3 SASI_Mm02_00319959 predicted 2358
4 SASI_Mm01_00111966 predicted 3296
5 SASI_Mm01_00111967 predicted 4136
6 SASI_Mm01_00111969 predicted 4326
7 SASI_Mm01_00111970 predicted 684
8 SASI_Mm01_00111971 predicted 4297
9 SASI_Mm01_00111972 predicted 6876
10 SASI_Mm01_00111968 predicted 941
11 SASI_Mm01_00111973 predicted 3507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011132
VALIDATED
POLE MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon, catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-5662s21c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-361s21c1
Sequence:CCGGTTGCCCTATATGCCGTATTTCCTCGAGGAAATACGGCATATAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-6939s21c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-4450s1c1
Sequence:CCGGCGCCATATCTACCTGTACCATCTCGAGATGGTACAGGTAGATATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-2245s21c1
Sequence:CCGGTATTGCCGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-5593s1c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-1504s21c1
Sequence:CCGGTTCGCCCTGTGCACCATTATTCTCGAGAATAATGGTGCACAGGGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011132.1-3228s1c1
Sequence:CCGGCCGCTATATCATCTCCCGAAACTCGAGTTTCGGGAGATGATATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-2132s1c1
Sequence:CCGGCCCGTGAAGAACAGGCTAAATCTCGAGATTTAGCCTGTTCTTCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-6870s1c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011132
VALIDATED
POLE MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon, catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-5662s21c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000328839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-361s21c1
Sequence:CCGGTTGCCCTATATGCCGTATTTCCTCGAGGAAATACGGCATATAGGGCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000328838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-6939s21c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-4450s1c1
Sequence:CCGGCGCCATATCTACCTGTACCATCTCGAGATGGTACAGGTAGATATGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000353501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-2245s21c1
Sequence:CCGGTATTGCCGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGGCAATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-5593s1c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000328840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-1504s21c1
Sequence:CCGGTTCGCCCTGTGCACCATTATTCTCGAGAATAATGGTGCACAGGGCGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011132.1-3228s1c1
Sequence:CCGGCCGCTATATCATCTCCCGAAACTCGAGTTTCGGGAGATGATATAGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-2132s1c1
Sequence:CCGGCCCGTGAAGAACAGGCTAAATCTCGAGATTTAGCCTGTTCTTCACGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-6870s1c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011132
VALIDATED
POLE MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon, catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-5662s21c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011132.2-361s21c1
Sequence:CCGGTTGCCCTATATGCCGTATTTCCTCGAGGAAATACGGCATATAGGGCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-6939s21c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-4450s1c1
Sequence:CCGGCGCCATATCTACCTGTACCATCTCGAGATGGTACAGGTAGATATGGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-2245s21c1
Sequence:CCGGTATTGCCGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGGCAATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-5593s1c1
Sequence:CCGGGCCAACTTCAATCGCATCATTCTCGAGAATGATGCGATTGAAGTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011132.2-1504s21c1
Sequence:CCGGTTCGCCCTGTGCACCATTATTCTCGAGAATAATGGTGCACAGGGCGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011132.1-3228s1c1
Sequence:CCGGCCGCTATATCATCTCCCGAAACTCGAGTTTCGGGAGATGATATAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-2132s1c1
Sequence:CCGGCCCGTGAAGAACAGGCTAAATCTCGAGATTTAGCCTGTTCTTCACGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011132.1-6870s1c1
Sequence:CCGGCACTTTGGTATCCCACACCTACTCGAGTAGGTGTGGGATACCAAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006231
VALIDATED
POLE MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), epsilon, catalytic subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-285s1c1
Sequence:CCGGGCAGTGGATTACTACTTTATTCTCGAGAATAAAGTAGTAATCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-678s1c1
Sequence:CCGGGCTGACCAGTTGGACAACATTCTCGAGAATGTTGTCCAACTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006231.1-467s1c1
Sequence:CCGGGCCAAATCACTTGGTGGGTTTCTCGAGAAACCCACCAAGTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-6548s1c1
Sequence:CCGGCCTGTGTAAAGACTCTTCCTTCTCGAGAAGGAAGAGTCTTTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-4212s1c1
Sequence:CCGGCGCTCCAACATGGTCTACAATCTCGAGATTGTAGACCATGTTGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006231
VALIDATED
POLE MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), epsilon, catalytic subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-285s1c1
Sequence:CCGGGCAGTGGATTACTACTTTATTCTCGAGAATAAAGTAGTAATCCACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-678s1c1
Sequence:CCGGGCTGACCAGTTGGACAACATTCTCGAGAATGTTGTCCAACTGGTCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006231.1-467s1c1
Sequence:CCGGGCCAAATCACTTGGTGGGTTTCTCGAGAAACCCACCAAGTGATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-6548s1c1
Sequence:CCGGCCTGTGTAAAGACTCTTCCTTCTCGAGAAGGAAGAGTCTTTACACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000052974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-4212s1c1
Sequence:CCGGCGCTCCAACATGGTCTACAATCTCGAGATTGTAGACCATGTTGGAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006231
VALIDATED
POLE MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), epsilon, catalytic subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-285s1c1
Sequence:CCGGGCAGTGGATTACTACTTTATTCTCGAGAATAAAGTAGTAATCCACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-678s1c1
Sequence:CCGGGCTGACCAGTTGGACAACATTCTCGAGAATGTTGTCCAACTGGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006231.1-467s1c1
Sequence:CCGGGCCAAATCACTTGGTGGGTTTCTCGAGAAACCCACCAAGTGATTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006231.1-6548s1c1
Sequence:CCGGCCTGTGTAAAGACTCTTCCTTCTCGAGAAGGAAGAGTCTTTACACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006231.1-4212s1c1
Sequence:CCGGCGCTCCAACATGGTCTACAATCTCGAGATTGTAGACCATGTTGGAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???