EMAIL THIS PAGE TO A FRIEND

POLG

polymerase (DNA directed), gamma

70 Gene Product Result for
Synonyms: MDP1 MIRAS MTDPS4A MTDPS4B PEO POLG1 POLGA SANDO SCAE
UniProtKB ID: P54098, Q8NFM2, Q92515
Gene ID:
Human(5428) Summary: Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18975) polymerase (DNA directed), gamma
Rat(85472) polymerase (DNA directed), gamma
naked mole-rat(101700433) polymerase (DNA directed), gamma
domestic guinea pig(100728907) polymerase (DNA directed), gamma
cow(533090) polymerase (DNA directed), gamma
sheep(101123414) polymerase (DNA directed), gamma
Zebrafish(100150924) polymerase (DNA directed), gamma
dog(488732) polymerase (DNA directed), gamma
chicken(404292) polymerase (DNA directed), gamma
domestic cat(101083771) polymerase (DNA directed), gamma
Horse(100053827) polymerase (DNA directed), gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126131 Rosetta Predictions human pricing
NM_002693 Rosetta Predictions human pricing
NM_053528 Rosetta Predictions rat pricing
NM_017462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328327 predicted 3242
2 SASI_Hs02_00328328 predicted 3058
3 SASI_Hs02_00328329 predicted 3323
4 SASI_Hs02_00328330 predicted 1873
5 SASI_Hs02_00328331 predicted 3456
6 SASI_Hs02_00328332 predicted 1312
7 SASI_Hs02_00328333 predicted 3843
8 SASI_Hs02_00328334 predicted 2953
9 SASI_Hs02_00328335 predicted 3109
10 SASI_Hs02_00328336 predicted 3219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075124 predicted 3252
2 SASI_Hs01_00075125 predicted 3070
3 SASI_Hs01_00075126 predicted 3327
4 SASI_Hs01_00075128 predicted 1886
5 SASI_Hs01_00075129 predicted 3464
6 SASI_Hs01_00075131 predicted 1324
7 SASI_Hs01_00075132 predicted 3847
8 SASI_Hs01_00075133 predicted 2964
9 SASI_Hs02_00334263 predicted 3126
10 SASI_Hs02_00334264 predicted 3230
11 SASI_Hs01_00075127 predicted 2473
12 SASI_Hs01_00075130 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030655 predicted 3422
2 SASI_Rn01_00030658 predicted 2183
3 SASI_Rn01_00030659 predicted 3281
4 SASI_Rn01_00030660 predicted 767
5 SASI_Rn01_00030661 predicted 1662
6 SASI_Rn01_00030662 predicted 2135
7 SASI_Rn01_00030663 predicted 790
8 SASI_Rn01_00030664 predicted 901
9 SASI_Rn02_00266146 predicted 3274
10 SASI_Rn02_00266147 predicted 2115
11 SASI_Rn01_00030656 predicted 2880
12 SASI_Rn01_00030657 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085871 predicted 1134
2 SASI_Mm01_00085872 predicted 3784
3 SASI_Mm01_00085873 predicted 2694
4 SASI_Mm01_00085874 predicted 3609
5 SASI_Mm01_00085875 predicted 3647
6 SASI_Mm01_00085876 predicted 2503
7 SASI_Mm01_00085877 predicted 3641
8 SASI_Mm01_00085878 predicted 3546
9 SASI_Mm01_00085879 predicted 2418
10 SASI_Mm01_00085880 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017462
VALIDATED
POLG MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3492s21c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-1731s21c1
Sequence:CCGGTCTCAGGAGAGAGGTACAAAGCTCGAGCTTTGTACCTCTCTCCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3557s21c1
Sequence:CCGGGTTGTCCAGGGAGAGTTTATACTCGAGTATAAACTCTCCCTGGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017462.2-4374s21c1
Sequence:CCGGTTCTAAGGTGATGGGAATAAACTCGAGTTTATTCCCATCACCTTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017462.2-3144s21c1
Sequence:CCGGTCAACTATGGCCGCATCTATGCTCGAGCATAGATGCGGCCATAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-1109s1c1
Sequence:CCGGCGATACTATGAGCATGCACATCTCGAGATGTGCATGCTCATAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3711s1c1
Sequence:CCGGGCCTATAAGCTGGGTCTGAATCTCGAGATTCAGACCCAGCTTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017462.1-2426s1c1
Sequence:CCGGCGGACCTTATAATGATGTGAACTCGAGTTCACATCATTATAAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3412s1c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-696s1c1
Sequence:CCGGGCCTCGTTATTGGAGGCCCAACTCGAGTTGGGCCTCCAATAACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017462
VALIDATED
POLG MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3492s21c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-1731s21c1
Sequence:CCGGTCTCAGGAGAGAGGTACAAAGCTCGAGCTTTGTACCTCTCTCCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3557s21c1
Sequence:CCGGGTTGTCCAGGGAGAGTTTATACTCGAGTATAAACTCTCCCTGGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017462.2-4374s21c1
Sequence:CCGGTTCTAAGGTGATGGGAATAAACTCGAGTTTATTCCCATCACCTTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017462.2-3144s21c1
Sequence:CCGGTCAACTATGGCCGCATCTATGCTCGAGCATAGATGCGGCCATAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-1109s1c1
Sequence:CCGGCGATACTATGAGCATGCACATCTCGAGATGTGCATGCTCATAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3711s1c1
Sequence:CCGGGCCTATAAGCTGGGTCTGAATCTCGAGATTCAGACCCAGCTTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017462.1-2426s1c1
Sequence:CCGGCGGACCTTATAATGATGTGAACTCGAGTTCACATCATTATAAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3412s1c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-696s1c1
Sequence:CCGGGCCTCGTTATTGGAGGCCCAACTCGAGTTGGGCCTCCAATAACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017462
VALIDATED
POLG MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3492s21c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-1731s21c1
Sequence:CCGGTCTCAGGAGAGAGGTACAAAGCTCGAGCTTTGTACCTCTCTCCTGAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017462.2-3557s21c1
Sequence:CCGGGTTGTCCAGGGAGAGTTTATACTCGAGTATAAACTCTCCCTGGACAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017462.2-4374s21c1
Sequence:CCGGTTCTAAGGTGATGGGAATAAACTCGAGTTTATTCCCATCACCTTAGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017462.2-3144s21c1
Sequence:CCGGTCAACTATGGCCGCATCTATGCTCGAGCATAGATGCGGCCATAGTTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-1109s1c1
Sequence:CCGGCGATACTATGAGCATGCACATCTCGAGATGTGCATGCTCATAGTATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3711s1c1
Sequence:CCGGGCCTATAAGCTGGGTCTGAATCTCGAGATTCAGACCCAGCTTATAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017462.1-2426s1c1
Sequence:CCGGCGGACCTTATAATGATGTGAACTCGAGTTCACATCATTATAAGGTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-3412s1c1
Sequence:CCGGCCATGTCTGATACACCACGTACTCGAGTACGTGGTGTATCAGACATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017462.1-696s1c1
Sequence:CCGGGCCTCGTTATTGGAGGCCCAACTCGAGTTGGGCCTCCAATAACGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002693
VALIDATED
POLG MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1095s21c1
Sequence:CCGGTTCCTTTGACCGAGCTCATATCTCGAGATATGAGCTCGGTCAAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3171s21c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3922s21c1
Sequence:CCGGCAGGGTGAAGCGCTGGATATTCTCGAGAATATCCAGCGCTTCACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-2680s21c1
Sequence:CCGGTTCTGGAGGAACGCCCATAAACTCGAGTTTATGGGCGTTCCTCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1351s21c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3625s1c1
Sequence:CCGGGCCATGAAGTGGCTGTTTGAACTCGAGTTCAAACAGCCACTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1755s1c1
Sequence:CCGGCCTGCAAGAATTTAAGCAGAACTCGAGTTCTGCTTAAATTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3171s1c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-2322s1c1
Sequence:CCGGGCTCACTGACAATAGTGCCATCTCGAGATGGCACTATTGTCAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1351s1c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002693
VALIDATED
POLG MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1095s21c1
Sequence:CCGGTTCCTTTGACCGAGCTCATATCTCGAGATATGAGCTCGGTCAAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3171s21c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3922s21c1
Sequence:CCGGCAGGGTGAAGCGCTGGATATTCTCGAGAATATCCAGCGCTTCACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-2680s21c1
Sequence:CCGGTTCTGGAGGAACGCCCATAAACTCGAGTTTATGGGCGTTCCTCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1351s21c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3625s1c1
Sequence:CCGGGCCATGAAGTGGCTGTTTGAACTCGAGTTCAAACAGCCACTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1755s1c1
Sequence:CCGGCCTGCAAGAATTTAAGCAGAACTCGAGTTCTGCTTAAATTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3171s1c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-2322s1c1
Sequence:CCGGGCTCACTGACAATAGTGCCATCTCGAGATGGCACTATTGTCAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1351s1c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002693
VALIDATED
POLG MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1095s21c1
Sequence:CCGGTTCCTTTGACCGAGCTCATATCTCGAGATATGAGCTCGGTCAAAGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3171s21c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002693.2-3922s21c1
Sequence:CCGGCAGGGTGAAGCGCTGGATATTCTCGAGAATATCCAGCGCTTCACCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-2680s21c1
Sequence:CCGGTTCTGGAGGAACGCCCATAAACTCGAGTTTATGGGCGTTCCTCCAGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002693.2-1351s21c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3625s1c1
Sequence:CCGGGCCATGAAGTGGCTGTTTGAACTCGAGTTCAAACAGCCACTTCATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1755s1c1
Sequence:CCGGCCTGCAAGAATTTAAGCAGAACTCGAGTTCTGCTTAAATTCTTGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-3171s1c1
Sequence:CCGGGCGCTTACTAATGCAGTTTAACTCGAGTTAAACTGCATTAGTAAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-2322s1c1
Sequence:CCGGGCTCACTGACAATAGTGCCATCTCGAGATGGCACTATTGTCAGTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002693.1-1351s1c1
Sequence:CCGGGCAGAGGTGCACAGACTTTATCTCGAGATAAAGTCTGTGCACCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???