EMAIL THIS PAGE TO A FRIEND

POLH

polymerase (DNA directed), eta

50 Gene Product Result for
Synonyms: RAD30 RAD30A XP-V XPV
UniProtKB ID: Q9Y253, Q7L8E3, Q96BC4, Q9BX13
Gene ID:
Human(5429) Summary: This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. [provided by RefSeq, Jul 2008]
Mouse(80905) polymerase (DNA directed), eta (RAD 30 related)
Rat(316235) polymerase (DNA directed), eta
Thale Cress(834503) Y-family DNA polymerase H
Zebrafish(678520) polymerase (DNA directed), eta
dog(474915) polymerase (DNA directed), eta
Horse(100067518) polymerase (DNA directed), eta
domestic cat(101088666) polymerase (DNA directed), eta
chicken(395102) polymerase (DNA directed), eta
naked mole-rat(101708877) polymerase (DNA directed), eta
Domestic Rabbit(100357494) polymerase (DNA directed), eta
domestic guinea pig(100732400) polymerase (DNA directed), eta
cow(513606) polymerase (DNA directed), eta
sheep(101115320) polymerase (DNA directed), eta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006502 Rosetta Predictions human pricing
NM_001108204 Rosetta Predictions rat pricing
NM_030715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088494 predicted 633
2 SASI_Hs01_00088495 predicted 906
3 SASI_Hs02_00341708 predicted 393
4 SASI_Hs01_00088497 predicted 1040
5 SASI_Hs01_00088498 predicted 1100
6 SASI_Hs01_00088499 predicted 1471
7 SASI_Hs02_00341709 predicted 1324
8 SASI_Hs01_00088500 predicted 1466
9 SASI_Hs01_00088501 predicted 729
10 SASI_Hs01_00088502 predicted 2248
11 SASI_Hs01_00088496 predicted 1051
12 SASI_Hs01_00088503 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236344 predicted 1507
2 SASI_Rn02_00236345 predicted 446
3 SASI_Rn02_00236346 predicted 2035
4 SASI_Rn02_00236347 predicted 392
5 SASI_Rn02_00236348 predicted 1270
6 SASI_Rn02_00236349 predicted 390
7 SASI_Rn02_00236350 predicted 461
8 SASI_Rn02_00236351 predicted 614
9 SASI_Rn02_00236352 predicted 579
10 SASI_Rn02_00236353 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112365 predicted 319
2 SASI_Mm01_00112366 predicted 1149
3 SASI_Mm01_00112367 predicted 240
4 SASI_Mm01_00112368 predicted 663
5 SASI_Mm01_00112369 predicted 1592
6 SASI_Mm01_00112371 predicted 501
7 SASI_Mm01_00112372 predicted 367
8 SASI_Mm01_00112373 predicted 378
9 SASI_Mm02_00336903 predicted 698
10 SASI_Mm02_00336904 predicted 1423
11 SASI_Mm01_00112364 predicted 1967
12 SASI_Mm01_00112370 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030715
VALIDATED
POLH MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), eta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1157s21c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-2017s21c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1570s21c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-1571s1c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-637s1c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-2018s1c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-636s21c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-1158s1c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-429s1c1
Sequence:CCGGGCGGATGATGCTAAGAAGTTACTCGAGTAACTTCTTAGCATCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030715
VALIDATED
POLH MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), eta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1157s21c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-2017s21c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1570s21c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-1571s1c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-637s1c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-2018s1c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-636s21c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-1158s1c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-429s1c1
Sequence:CCGGGCGGATGATGCTAAGAAGTTACTCGAGTAACTTCTTAGCATCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030715
VALIDATED
POLH MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), eta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1157s21c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-2017s21c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-1570s21c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-1571s1c1
Sequence:CCGGCGACTCAAGTTGTCAGCCAAACTCGAGTTTGGCTGACAACTTGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-637s1c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030715.2-2018s1c1
Sequence:CCGGGCTCGATTCTCCAGCTTACAACTCGAGTTGTAAGCTGGAGAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030715.3-636s21c1
Sequence:CCGGGTCAGCCTATCTCAGCAGATTCTCGAGAATCTGCTGAGATAGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-1158s1c1
Sequence:CCGGCCAGTTAAACCCAGGCAGTTACTCGAGTAACTGCCTGGGTTTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030715.2-429s1c1
Sequence:CCGGGCGGATGATGCTAAGAAGTTACTCGAGTAACTTCTTAGCATCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006502
VALIDATED
POLH MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), eta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006502.2-4662s21c1
Sequence:CCGGCATACAGGTAAACCCTATTATCTCGAGATAATAGGGTTTACCTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-405s21c1
Sequence:GTACCGGGTGCAGTTGTACAGTACAAATCTCGAGATTTGTACTGTACAACTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2248s21c1
Sequence:GTACCGGAGAACACATGGACTATCATTTCTCGAGAAATGATAGTCCATGTGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006502.2-455s21c1
Sequence:GTACCGGAGTTATGAAGCTCGTGCATTTCTCGAGAAATGCACGAGCTTCATAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2365s21c1
Sequence:CCGGCCCTTTGGCCTGCACTAATAACTCGAGTTATTAGTGCAGGCCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-2263s1c1
Sequence:CCGGGCCGTATCTCATCAAGGCAAACTCGAGTTTGCCTTGATGAGATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1536s1c1
Sequence:CCGGCCCTTCATCTTCTACAGACATCTCGAGATGTCTGTAGAAGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-439s1c1
Sequence:CCGGGCTAAGAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1401s1c1
Sequence:CCGGCCGCTATGATGCTCACAAGATCTCGAGATCTTGTGAGCATCATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006502
VALIDATED
POLH MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), eta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006502.2-4662s21c1
Sequence:CCGGCATACAGGTAAACCCTATTATCTCGAGATAATAGGGTTTACCTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-405s21c1
Sequence:GTACCGGGTGCAGTTGTACAGTACAAATCTCGAGATTTGTACTGTACAACTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2248s21c1
Sequence:GTACCGGAGAACACATGGACTATCATTTCTCGAGAAATGATAGTCCATGTGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006502.2-455s21c1
Sequence:GTACCGGAGTTATGAAGCTCGTGCATTTCTCGAGAAATGCACGAGCTTCATAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2365s21c1
Sequence:CCGGCCCTTTGGCCTGCACTAATAACTCGAGTTATTAGTGCAGGCCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-2263s1c1
Sequence:CCGGGCCGTATCTCATCAAGGCAAACTCGAGTTTGCCTTGATGAGATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1536s1c1
Sequence:CCGGCCCTTCATCTTCTACAGACATCTCGAGATGTCTGTAGAAGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-439s1c1
Sequence:CCGGGCTAAGAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1401s1c1
Sequence:CCGGCCGCTATGATGCTCACAAGATCTCGAGATCTTGTGAGCATCATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006502
VALIDATED
POLH MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), eta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006502.2-4662s21c1
Sequence:CCGGCATACAGGTAAACCCTATTATCTCGAGATAATAGGGTTTACCTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-405s21c1
Sequence:GTACCGGGTGCAGTTGTACAGTACAAATCTCGAGATTTGTACTGTACAACTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2248s21c1
Sequence:GTACCGGAGAACACATGGACTATCATTTCTCGAGAAATGATAGTCCATGTGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006502.2-455s21c1
Sequence:GTACCGGAGTTATGAAGCTCGTGCATTTCTCGAGAAATGCACGAGCTTCATAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006502.2-2365s21c1
Sequence:CCGGCCCTTTGGCCTGCACTAATAACTCGAGTTATTAGTGCAGGCCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-2263s1c1
Sequence:CCGGGCCGTATCTCATCAAGGCAAACTCGAGTTTGCCTTGATGAGATACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1536s1c1
Sequence:CCGGCCCTTCATCTTCTACAGACATCTCGAGATGTCTGTAGAAGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-439s1c1
Sequence:CCGGGCTAAGAAGTTATGTCCAGATCTCGAGATCTGGACATAACTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006502.1-1401s1c1
Sequence:CCGGCCGCTATGATGCTCACAAGATCTCGAGATCTTGTGAGCATCATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)