EMAIL THIS PAGE TO A FRIEND

POLK

polymerase (DNA directed) kappa

136 Gene Product Result for
Synonyms: DINB1 DINP POLQ
Gene ID:
Human(51426) Summary: External and internal DNA-damaging agents continually threaten the integrity of genetic material in cells. Although a variety of repair mechanisms exist to remove the resulting lesions, some lesions escape repair and block the replication machinery. Members of the Y family of DNA polymerases, such as POLK, permit the continuity of the replication fork by allowing replication through such DNA lesions. Each Y family polymerase has a unique DNA-damage bypass and fidelity profile. POLK is specialized for the extension step of lesion bypass (summary by Lone et al., 2007 [PubMed 17317631]
Mouse(27015) polymerase (DNA directed), kappa
Rat(171525) polymerase (DNA directed) kappa
naked mole-rat(101718580) polymerase (DNA directed) kappa
Domestic Rabbit(100352218) polymerase (DNA directed) kappa
domestic guinea pig(100726233) polymerase (DNA directed) kappa
cow(541218) polymerase (DNA directed) kappa
sheep(101109360) polymerase (DNA directed) kappa
Zebrafish(562749) polymerase (DNA directed) kappa
chicken(374003) polymerase (DNA directed) kappa
dog(479180) polymerase (DNA directed) kappa
domestic cat(101099613) polymerase (DNA directed) kappa
Horse(100065534) polymerase (DNA directed) kappa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409422 Anti-POLK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108294 Anti-POLK antibody produced in rabbit affinity isolated antibody dog, human, mouse, rat, horse, pig
western blot pricing
AV48793 Anti-POLK antibody produced in rabbit affinity isolated antibody bovine, human, horse, dog, mouse, rat, pig
western blot pricing
SAB1410928 Anti-POLK antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012035 Anti-POLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunofluorescence, western blot pricing
HPA057303 Anti-POLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA068117 Anti-POLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA069375 Anti-POLK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2103669 Anti-POLK, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, horse, canine, mouse, bovine
western blot pricing
WH0051426M1 Monoclonal Anti-POLK antibody produced in mouse clone 6F2, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405097 Monoclonal Anti-POLK antibody produced in mouse clone 4F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016218 siRNAs that have been validated in the lab human pricing
NM_138516 Rosetta Predictions rat pricing
NM_012048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016218 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117838 validated 467
2 SASI_Hs01_00117839 predicted 1623
3 SASI_Hs02_00349074 predicted 1299
4 SASI_Hs02_00349075 predicted 1843
5 SASI_Hs01_00117840 predicted 2335
6 SASI_Hs01_00117841 predicted 209
7 SASI_Hs01_00117842 predicted 1579
8 SASI_Hs01_00117843 predicted 562
9 SASI_Hs01_00117844 predicted 1681
10 SASI_Hs01_00117845 predicted 441
11 SASI_Hs01_00117846 predicted 2014
12 SASI_Hs01_00117847 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268118 predicted 1540
2 SASI_Rn02_00268119 predicted 2401
3 SASI_Rn02_00268120 predicted 1881
4 SASI_Rn02_00268121 predicted 516
5 SASI_Rn02_00268122 predicted 789
6 SASI_Rn02_00268123 predicted 456
7 SASI_Rn02_00268124 predicted 2040
8 SASI_Rn02_00268125 predicted 1440
9 SASI_Rn02_00268126 predicted 1326
10 SASI_Rn02_00268127 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082985 predicted 1867
2 SASI_Mm01_00082986 predicted 462
3 SASI_Mm01_00082987 predicted 2394
4 SASI_Mm02_00322019 predicted 2499
5 SASI_Mm01_00082988 predicted 1700
6 SASI_Mm02_00322020 predicted 440
7 SASI_Mm01_00082989 predicted 2305
8 SASI_Mm01_00082990 predicted 1758
9 SASI_Mm01_00082991 predicted 1339
10 SASI_Mm01_00082992 predicted 2486
11 SASI_Mm01_00082993 predicted 2097
12 SASI_Mm01_00082994 predicted 2253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016218
VALIDATED
POLK MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) kappa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-641s21c1
Sequence:CCGGAGGAAATACTTGCTGATTATGCTCGAGCATAATCAGCAAGTATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-372s21c1
Sequence:CCGGATTAGAACAAAGCCGAAATTTCTCGAGAAATTTCGGCTTTGTTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1452s21c1
Sequence:CCGGGGGTAGAACTGTTACCATTAACTCGAGTTAATGGTAACAGTTCTACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-174s21c1
Sequence:CCGGAGGAATGGAAGGATTAGATAACTCGAGTTATCTAATCCTTCCATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1845s21c1
Sequence:CCGGTAAATGTGAAGCCGTGAATAACTCGAGTTATTCACGGCTTCACATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-1628s1c1
Sequence:CCGGGCCATTGCTAAGGAATTGCTACTCGAGTAGCAATTCCTTAGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2622s1c1
Sequence:CCGGCAGTTAATCAACCCAAAGAAACTCGAGTTTCTTTGGGTTGATTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2753s1c1
Sequence:CCGGCCCAAACATACCCTTGATATACTCGAGTATATCAAGGGTATGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-3169s1c1
Sequence:CCGGGCATTGATCCTAGTGTCTTTACTCGAGTAAAGACACTAGGATCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016218.1-2510s1c1
Sequence:CCGGCCTGTTTGTAACGTAGAACAACTCGAGTTGTTCTACGTTACAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016218
VALIDATED
POLK MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) kappa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-641s21c1
Sequence:CCGGAGGAAATACTTGCTGATTATGCTCGAGCATAATCAGCAAGTATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-372s21c1
Sequence:CCGGATTAGAACAAAGCCGAAATTTCTCGAGAAATTTCGGCTTTGTTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1452s21c1
Sequence:CCGGGGGTAGAACTGTTACCATTAACTCGAGTTAATGGTAACAGTTCTACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-174s21c1
Sequence:CCGGAGGAATGGAAGGATTAGATAACTCGAGTTATCTAATCCTTCCATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1845s21c1
Sequence:CCGGTAAATGTGAAGCCGTGAATAACTCGAGTTATTCACGGCTTCACATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-1628s1c1
Sequence:CCGGGCCATTGCTAAGGAATTGCTACTCGAGTAGCAATTCCTTAGCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2622s1c1
Sequence:CCGGCAGTTAATCAACCCAAAGAAACTCGAGTTTCTTTGGGTTGATTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2753s1c1
Sequence:CCGGCCCAAACATACCCTTGATATACTCGAGTATATCAAGGGTATGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-3169s1c1
Sequence:CCGGGCATTGATCCTAGTGTCTTTACTCGAGTAAAGACACTAGGATCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016218.1-2510s1c1
Sequence:CCGGCCTGTTTGTAACGTAGAACAACTCGAGTTGTTCTACGTTACAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016218
VALIDATED
POLK MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) kappa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-641s21c1
Sequence:CCGGAGGAAATACTTGCTGATTATGCTCGAGCATAATCAGCAAGTATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-372s21c1
Sequence:CCGGATTAGAACAAAGCCGAAATTTCTCGAGAAATTTCGGCTTTGTTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1452s21c1
Sequence:CCGGGGGTAGAACTGTTACCATTAACTCGAGTTAATGGTAACAGTTCTACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-174s21c1
Sequence:CCGGAGGAATGGAAGGATTAGATAACTCGAGTTATCTAATCCTTCCATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016218.2-1845s21c1
Sequence:CCGGTAAATGTGAAGCCGTGAATAACTCGAGTTATTCACGGCTTCACATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-1628s1c1
Sequence:CCGGGCCATTGCTAAGGAATTGCTACTCGAGTAGCAATTCCTTAGCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2622s1c1
Sequence:CCGGCAGTTAATCAACCCAAAGAAACTCGAGTTTCTTTGGGTTGATTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-2753s1c1
Sequence:CCGGCCCAAACATACCCTTGATATACTCGAGTATATCAAGGGTATGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016218.1-3169s1c1
Sequence:CCGGGCATTGATCCTAGTGTCTTTACTCGAGTAAAGACACTAGGATCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016218.1-2510s1c1
Sequence:CCGGCCTGTTTGTAACGTAGAACAACTCGAGTTGTTCTACGTTACAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012048
VALIDATED
POLK MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) kappa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-586s21c1
Sequence:CCGGATGTTGGCTACTTCGAATTACCTCGAGGTAATTCGAAGTAGCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-471s1c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-1854s21c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-427s21c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-3940s1c1
Sequence:CCGGGCACAGTCTTAACCTGACTTTCTCGAGAAAGTCAGGTTAAGACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-427s1c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-1854s1c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-471s21c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012048.2-2934s21c1
Sequence:CCGGGAATTTCATTCCCAGTATATACTCGAGTATATACTGGGAATGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012048.1-2342s1c1
Sequence:CCGGGCAAAGAGGAATGTCCTGATACTCGAGTATCAGGACATTCCTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012048
VALIDATED
POLK MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) kappa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-586s21c1
Sequence:CCGGATGTTGGCTACTTCGAATTACCTCGAGGTAATTCGAAGTAGCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-471s1c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-1854s21c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-427s21c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-3940s1c1
Sequence:CCGGGCACAGTCTTAACCTGACTTTCTCGAGAAAGTCAGGTTAAGACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-427s1c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-1854s1c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-471s21c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012048.2-2934s21c1
Sequence:CCGGGAATTTCATTCCCAGTATATACTCGAGTATATACTGGGAATGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012048.1-2342s1c1
Sequence:CCGGGCAAAGAGGAATGTCCTGATACTCGAGTATCAGGACATTCCTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012048
VALIDATED
POLK MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) kappa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-586s21c1
Sequence:CCGGATGTTGGCTACTTCGAATTACCTCGAGGTAATTCGAAGTAGCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-471s1c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-1854s21c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-427s21c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-3940s1c1
Sequence:CCGGGCACAGTCTTAACCTGACTTTCTCGAGAAAGTCAGGTTAAGACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-427s1c1
Sequence:CCGGGCTCAATTACAGGTTGACAAACTCGAGTTTGTCAACCTGTAATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012048.1-1854s1c1
Sequence:CCGGGCCCTTAGAAATGTCTCATAACTCGAGTTATGAGACATTTCTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012048.2-471s21c1
Sequence:CCGGCCGGAATTTGAACAATACCATCTCGAGATGGTATTGTTCAAATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012048.2-2934s21c1
Sequence:CCGGGAATTTCATTCCCAGTATATACTCGAGTATATACTGGGAATGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012048.1-2342s1c1
Sequence:CCGGGCAAAGAGGAATGTCCTGATACTCGAGTATCAGGACATTCCTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)