EMAIL THIS PAGE TO A FRIEND

POLL

polymerase (DNA directed), lambda

57 Gene Product Result for
Synonyms: BETAN POLKAPPA
UniProtKB ID: Q9UGP5, D3DR76, Q5JQP5, Q6NUM2, Q9HA10, Q9HB35
Gene ID:
Human(27343) Summary: This gene encodes a DNA polymerase. DNA polymerases catalyze DNA-template-directed extension of the 3'-end of a DNA strand. This particular polymerase, which is a member of the X family of DNA polymerases, likely plays a role in non-homologous end joining and other DNA repair processes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2010]
Mouse(56626) polymerase (DNA directed), lambda
Rat(361767) polymerase (DNA directed), lambda
Zebrafish(406697) polymerase (DNA directed), lambda
chicken(423853) polymerase (DNA directed), lambda
Horse(100070125) polymerase (DNA directed), lambda
domestic cat(101084138) polymerase (DNA directed), lambda
dog(608341) polymerase (DNA directed), lambda
cow(522307) polymerase (DNA directed), lambda
cow(281415) polymerase (DNA directed), lambda
sheep(101102947) polymerase (DNA directed), lambda
Goat(100861350) polymerase (DNA directed), lambda
domestic guinea pig(100729389) polymerase (DNA directed), lambda
Domestic Rabbit(100351030) polymerase (DNA directed), lambda
naked mole-rat(101696600) polymerase (DNA directed), lambda
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013274 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063651 MISSION® esiRNA esiRNA human POLL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013274 Rosetta Predictions human pricing
NM_001014168 Rosetta Predictions rat pricing
NM_020032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013461 predicted 1516
2 SASI_Hs02_00344517 predicted 1573
3 SASI_Hs01_00013462 predicted 615
4 SASI_Hs01_00013463 predicted 1124
5 SASI_Hs01_00013464 predicted 508
6 SASI_Hs01_00013465 predicted 956
7 SASI_Hs01_00013466 predicted 542
8 SASI_Hs01_00013467 predicted 632
9 SASI_Hs01_00013469 predicted 1150
10 SASI_Hs01_00013470 predicted 555
11 SASI_Hs01_00013468 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201659 predicted 1702
2 SASI_Rn01_00036060 predicted 739
3 SASI_Rn01_00036061 predicted 1560
4 SASI_Rn01_00036062 predicted 1802
5 SASI_Rn01_00036063 predicted 1029
6 SASI_Rn02_00201660 predicted 802
7 SASI_Rn01_00036064 predicted 1406
8 SASI_Rn01_00036067 predicted 483
9 SASI_Rn01_00036068 predicted 1235
10 SASI_Rn02_00201661 predicted 827
11 SASI_Rn01_00036065 predicted 1255
12 SASI_Rn01_00036066 predicted 783
13 SASI_Rn01_00036069 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189564 predicted 1606
2 SASI_Mm01_00189565 predicted 213
3 SASI_Mm01_00189568 predicted 1863
4 SASI_Mm01_00189567 predicted 653
5 SASI_Mm02_00325398 predicted 927
6 SASI_Mm01_00189569 predicted 520
7 SASI_Mm01_00189570 predicted 1822
8 SASI_Mm01_00189571 predicted 1444
9 SASI_Mm01_00189572 predicted 818
10 SASI_Mm01_00189573 predicted 1200
11 SASI_Mm01_00189566 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013274
POLL MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), lambda
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1653s21c1
Sequence:CCGGTGGTGATGTCGACGTGCTCATCTCGAGATGAGCACGTCGACATCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1856s21c1
Sequence:CCGGTGGTGCCCTATAGCGAGTTTGCTCGAGCAAACTCGCTATAGGGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-950s21c1
Sequence:CCGCAGCCCATCTCTGATGATGAAGCTCGAGCTTCATCATCAGAGATGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1343s21c1
Sequence:CCGGTGCGGAAGCTGGACCATATCACTCGAGTGATATGGTCCAGCTTCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1612s21c1
Sequence:CCGGTGTGTGGCATGTGGTTCATACCTCGAGGTATGAACCACATGCCACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1124s1c1
Sequence:CCGGCGACCAATCACAACCTCCATACTCGAGTATGGAGGTTGTGATTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1768s1c1
Sequence:CCGGCAAGAGGAGAATGGTCAGCAACTCGAGTTGCTGACCATTCTCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-759s1c1
Sequence:CCGGAGCTGGATTCAGCATCTTCATCTCGAGATGAAGATGCTGAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-619s1c1
Sequence:CCGGACTCACATTGTGGTGGATGAACTCGAGTTCATCCACCACAATGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1506s1c1
Sequence:CCGGCCTGAAGCATTACAGTGACTTCTCGAGAAGTCACTGTAATGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013274
POLL MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), lambda
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1653s21c1
Sequence:CCGGTGGTGATGTCGACGTGCTCATCTCGAGATGAGCACGTCGACATCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1856s21c1
Sequence:CCGGTGGTGCCCTATAGCGAGTTTGCTCGAGCAAACTCGCTATAGGGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-950s21c1
Sequence:CCGCAGCCCATCTCTGATGATGAAGCTCGAGCTTCATCATCAGAGATGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1343s21c1
Sequence:CCGGTGCGGAAGCTGGACCATATCACTCGAGTGATATGGTCCAGCTTCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1612s21c1
Sequence:CCGGTGTGTGGCATGTGGTTCATACCTCGAGGTATGAACCACATGCCACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1124s1c1
Sequence:CCGGCGACCAATCACAACCTCCATACTCGAGTATGGAGGTTGTGATTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1768s1c1
Sequence:CCGGCAAGAGGAGAATGGTCAGCAACTCGAGTTGCTGACCATTCTCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-759s1c1
Sequence:CCGGAGCTGGATTCAGCATCTTCATCTCGAGATGAAGATGCTGAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-619s1c1
Sequence:CCGGACTCACATTGTGGTGGATGAACTCGAGTTCATCCACCACAATGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1506s1c1
Sequence:CCGGCCTGAAGCATTACAGTGACTTCTCGAGAAGTCACTGTAATGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013274
POLL MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), lambda
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1653s21c1
Sequence:CCGGTGGTGATGTCGACGTGCTCATCTCGAGATGAGCACGTCGACATCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1856s21c1
Sequence:CCGGTGGTGCCCTATAGCGAGTTTGCTCGAGCAAACTCGCTATAGGGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-950s21c1
Sequence:CCGCAGCCCATCTCTGATGATGAAGCTCGAGCTTCATCATCAGAGATGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1343s21c1
Sequence:CCGGTGCGGAAGCTGGACCATATCACTCGAGTGATATGGTCCAGCTTCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013274.2-1612s21c1
Sequence:CCGGTGTGTGGCATGTGGTTCATACCTCGAGGTATGAACCACATGCCACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1124s1c1
Sequence:CCGGCGACCAATCACAACCTCCATACTCGAGTATGGAGGTTGTGATTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1768s1c1
Sequence:CCGGCAAGAGGAGAATGGTCAGCAACTCGAGTTGCTGACCATTCTCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-759s1c1
Sequence:CCGGAGCTGGATTCAGCATCTTCATCTCGAGATGAAGATGCTGAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-619s1c1
Sequence:CCGGACTCACATTGTGGTGGATGAACTCGAGTTCATCCACCACAATGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013274.2-1506s1c1
Sequence:CCGGCCTGAAGCATTACAGTGACTTCTCGAGAAGTCACTGTAATGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020032
VALIDATED
POLL MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), lambda
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-816s21c1
Sequence:CCGGCAGAAGGCAACTAACTACAATCTCGAGATTGTAGTTAGTTGCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-257s21c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1205s21c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1261s21c1
Sequence:CCGGTTGAGCAGACGGTCCGGATATCTCGAGATATCCGGACCGTCTGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1975s21c1
Sequence:CCGGTCTCTCCTGGACAGGATTTATCTCGAGATAAATCCTGTCCAGGAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-257s1c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020032.1-771s1c1
Sequence:CCGGGCACCAGAAGCTCTGGATAAACTCGAGTTTATCCAGAGCTTCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-2038s1c1
Sequence:CCGGCCCTTCCCTGTTCAAGCAGAACTCGAGTTCTGCTTGAACAGGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-1205s1c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020032
VALIDATED
POLL MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), lambda
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-816s21c1
Sequence:CCGGCAGAAGGCAACTAACTACAATCTCGAGATTGTAGTTAGTTGCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-257s21c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1205s21c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1261s21c1
Sequence:CCGGTTGAGCAGACGGTCCGGATATCTCGAGATATCCGGACCGTCTGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1975s21c1
Sequence:CCGGTCTCTCCTGGACAGGATTTATCTCGAGATAAATCCTGTCCAGGAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-257s1c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020032.1-771s1c1
Sequence:CCGGGCACCAGAAGCTCTGGATAAACTCGAGTTTATCCAGAGCTTCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-2038s1c1
Sequence:CCGGCCCTTCCCTGTTCAAGCAGAACTCGAGTTCTGCTTGAACAGGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-1205s1c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020032
VALIDATED
POLL MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), lambda
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-816s21c1
Sequence:CCGGCAGAAGGCAACTAACTACAATCTCGAGATTGTAGTTAGTTGCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-257s21c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1205s21c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1261s21c1
Sequence:CCGGTTGAGCAGACGGTCCGGATATCTCGAGATATCCGGACCGTCTGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020032.2-1975s21c1
Sequence:CCGGTCTCTCCTGGACAGGATTTATCTCGAGATAAATCCTGTCCAGGAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-257s1c1
Sequence:CCGGACTCTTTGAGAAGCAGATTATCTCGAGATAATCTGCTTCTCAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020032.1-771s1c1
Sequence:CCGGGCACCAGAAGCTCTGGATAAACTCGAGTTTATCCAGAGCTTCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-2038s1c1
Sequence:CCGGCCCTTCCCTGTTCAAGCAGAACTCGAGTTCTGCTTGAACAGGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020032.1-1205s1c1
Sequence:CCGGCTTGAAGCACTACGATGACTTCTCGAGAAGTCATCGTAGTGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)