EMAIL THIS PAGE TO A FRIEND

POLN

polymerase (DNA directed) nu

56 Gene Product Result for
Synonyms: POL4P
UniProtKB ID: Q7Z5Q5, A2A336, Q4TTW4, Q6ZNF4
Gene ID:
Mouse(272158) DNA polymerase N
Zebrafish(566857) polymerase (DNA directed) nu
Horse(100051163) polymerase (DNA directed) nu
domestic cat(101083932) polymerase (DNA directed) nu
dog(488804) polymerase (DNA directed) nu
chicken(422892) polymerase (DNA directed) nu
cow(523362) polymerase (DNA directed) nu
sheep(101102646) polymerase (DNA directed) nu
domestic guinea pig(100731110) polymerase (DNA directed) nu
naked mole-rat(101707096) polymerase (DNA directed) nu
Domestic Rabbit(100349293) polymerase (DNA directed) nu
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097191 MISSION® esiRNA esiRNA human POLN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181808 Rosetta Predictions human pricing
NM_181857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170600 predicted 829
2 SASI_Hs01_00170601 predicted 1434
3 SASI_Hs01_00170603 predicted 1044
4 SASI_Hs01_00170604 predicted 997
5 SASI_Hs01_00170605 predicted 1638
6 SASI_Hs01_00170606 predicted 281
7 SASI_Hs01_00170607 predicted 1303
8 SASI_Hs02_00370414 predicted 502
9 SASI_Hs02_00370415 predicted 1059
10 SASI_Hs02_00370416 predicted 974
11 SASI_Hs01_00170599 predicted 2174
12 SASI_Hs01_00170602 predicted 1225
13 SASI_Hs01_00170608 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157340 predicted 254
2 SASI_Mm01_00157341 predicted 744
3 SASI_Mm01_00157342 predicted 798
4 SASI_Mm01_00157343 predicted 1598
5 SASI_Mm01_00157344 predicted 1638
6 SASI_Mm01_00157345 predicted 1274
7 SASI_Mm02_00349943 predicted 959
8 SASI_Mm01_00157346 predicted 905
9 SASI_Mm01_00157347 predicted 2265
10 SASI_Mm01_00157348 predicted 1383
11 SASI_Mm01_00157349 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181808
POLN MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) nu
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-53s1c1
Sequence:CCGGCCAGTGTTGCTCAGAAGATTACTCGAGTAATCTTCTGAGCAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-660s1c1
Sequence:CCGGCCTGGTGATAACTGTGATGTACTCGAGTACATCACAGTTATCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1572s1c1
Sequence:CCGGCCTTCATCCATTACCCAAGATCTCGAGATCTTGGGTAATGGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1725s1c1
Sequence:CCGGGCATCCTAATATCCAAGGTATCTCGAGATACCTTGGATATTAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1320s1c1
Sequence:CCGGCCATGCCATTCAGGTGAACAACTCGAGTTGTTCACCTGAATGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181808.2-1251s21c1
Sequence:CCGGTTATGGTTTATGGCAACTATTCTCGAGAATAGTTGCCATAAACCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181808
POLN MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) nu
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-53s1c1
Sequence:CCGGCCAGTGTTGCTCAGAAGATTACTCGAGTAATCTTCTGAGCAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-660s1c1
Sequence:CCGGCCTGGTGATAACTGTGATGTACTCGAGTACATCACAGTTATCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1572s1c1
Sequence:CCGGCCTTCATCCATTACCCAAGATCTCGAGATCTTGGGTAATGGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1725s1c1
Sequence:CCGGGCATCCTAATATCCAAGGTATCTCGAGATACCTTGGATATTAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1320s1c1
Sequence:CCGGCCATGCCATTCAGGTGAACAACTCGAGTTGTTCACCTGAATGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181808.2-1251s21c1
Sequence:CCGGTTATGGTTTATGGCAACTATTCTCGAGAATAGTTGCCATAAACCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181808
POLN MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) nu
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-53s1c1
Sequence:CCGGCCAGTGTTGCTCAGAAGATTACTCGAGTAATCTTCTGAGCAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-660s1c1
Sequence:CCGGCCTGGTGATAACTGTGATGTACTCGAGTACATCACAGTTATCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1572s1c1
Sequence:CCGGCCTTCATCCATTACCCAAGATCTCGAGATCTTGGGTAATGGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1725s1c1
Sequence:CCGGGCATCCTAATATCCAAGGTATCTCGAGATACCTTGGATATTAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181808.1-1320s1c1
Sequence:CCGGCCATGCCATTCAGGTGAACAACTCGAGTTGTTCACCTGAATGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181808.2-1251s21c1
Sequence:CCGGTTATGGTTTATGGCAACTATTCTCGAGAATAGTTGCCATAAACCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181857
POLN MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed) nu
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181857.1-2816s1c1
Sequence:CCGGCCTACTCACATGAAGGACATTCTCGAGAATGTCCTTCATGTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-2563s1c1
Sequence:CCGGGCCAGGTTAGTTGCCCAAATTCTCGAGAATTTGGGCAACTAACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1932s1c1
Sequence:CCGGGCACCCAATTAAGATTTCTAACTCGAGTTAGAAATCTTAATTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1264s1c1
Sequence:CCGGGCACCTTCATTTGAAGATTTACTCGAGTAAATCTTCAAATGAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-455s1c1
Sequence:CCGGCCTCCATTACTAAGCTCACATCTCGAGATGTGAGCTTAGTAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181857
POLN MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed) nu
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181857.1-2816s1c1
Sequence:CCGGCCTACTCACATGAAGGACATTCTCGAGAATGTCCTTCATGTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-2563s1c1
Sequence:CCGGGCCAGGTTAGTTGCCCAAATTCTCGAGAATTTGGGCAACTAACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1932s1c1
Sequence:CCGGGCACCCAATTAAGATTTCTAACTCGAGTTAGAAATCTTAATTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1264s1c1
Sequence:CCGGGCACCTTCATTTGAAGATTTACTCGAGTAAATCTTCAAATGAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-455s1c1
Sequence:CCGGCCTCCATTACTAAGCTCACATCTCGAGATGTGAGCTTAGTAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181857
POLN MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed) nu
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181857.1-2816s1c1
Sequence:CCGGCCTACTCACATGAAGGACATTCTCGAGAATGTCCTTCATGTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-2563s1c1
Sequence:CCGGGCCAGGTTAGTTGCCCAAATTCTCGAGAATTTGGGCAACTAACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1932s1c1
Sequence:CCGGGCACCCAATTAAGATTTCTAACTCGAGTTAGAAATCTTAATTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-1264s1c1
Sequence:CCGGGCACCTTCATTTGAAGATTTACTCGAGTAAATCTTCAAATGAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181857.1-455s1c1
Sequence:CCGGCCTCCATTACTAAGCTCACATCTCGAGATGTGAGCTTAGTAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)