EMAIL THIS PAGE TO A FRIEND

POLQ

polymerase (DNA directed), theta

47 Gene Product Result for
Synonyms: POLH PRO0327
UniProtKB ID: O75417, O95160, Q6VMB5
Gene ID:
Mouse(77782) polymerase (DNA directed), theta
Rat(288079) polymerase (DNA directed), theta
chicken(418326) polymerase (DNA directed), theta
Horse(100060882) polymerase (DNA directed), theta
domestic cat(101084214) polymerase (DNA directed), theta
dog(488003) polymerase (DNA directed), theta
domestic guinea pig(100716540) polymerase (DNA directed), theta
Domestic Rabbit(100341958) polymerase (DNA directed), theta
naked mole-rat(101721523) polymerase (DNA directed), theta
cow(535323) polymerase (DNA directed), theta
sheep(101109663) polymerase (DNA directed), theta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199420 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_006596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006596 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199420 Rosetta Predictions human pricing
NM_001105878 Rosetta Predictions rat pricing
NM_029977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061343 predicted 3297
2 SASI_Hs01_00061344 predicted 5722
3 SASI_Hs01_00061345 predicted 7484
4 SASI_Hs01_00061346 predicted 3572
5 SASI_Hs01_00061348 predicted 1116
6 SASI_Hs01_00061349 predicted 6698
7 SASI_Hs02_00372818 predicted 1966
8 SASI_Hs02_00372819 predicted 5673
9 SASI_Hs01_00061350 predicted 6510
10 SASI_Hs02_00372820 predicted 2458
11 SASI_Hs01_00061341 predicted 7939
12 SASI_Hs01_00061342 predicted 5948
13 SASI_Hs01_00061347 predicted 3860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213422 predicted 1100
2 SASI_Rn02_00213423 predicted 7240
3 SASI_Rn02_00213424 predicted 1168
4 SASI_Rn02_00213425 predicted 3301
5 SASI_Rn02_00213426 predicted 5462
6 SASI_Rn02_00213427 predicted 807
7 SASI_Rn02_00213428 predicted 7158
8 SASI_Rn02_00213429 predicted 4419
9 SASI_Rn02_00213430 predicted 2931
10 SASI_Rn02_00213431 predicted 4592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336309 predicted 5355
2 SASI_Mm01_00067054 predicted 1305
3 SASI_Mm01_00067055 predicted 5447
4 SASI_Mm01_00067056 predicted 3746
5 SASI_Mm01_00067057 predicted 3764
6 SASI_Mm02_00336310 predicted 3305
7 SASI_Mm02_00336311 predicted 4571
8 SASI_Mm02_00336312 predicted 6387
9 SASI_Mm01_00067062 predicted 5843
10 SASI_Mm01_00067063 predicted 7788
11 SASI_Mm01_00067058 predicted 4566
12 SASI_Mm01_00067059 predicted 7153
13 SASI_Mm01_00067060 predicted 1478
14 SASI_Mm01_00067061 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029977
POLQ MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), theta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-4296s21c1
Sequence:CCGGTGTTACTGATTCCCAATTAAACTCGAGTTTAATTGGGAATCAGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-518s21c1
Sequence:CCGGCACGGAAGAAAGCGTTGTTTACTCGAGTAAACAACGCTTTCTTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029977.1-8304s1c1
Sequence:CCGGCGGTCCAACAAGGAAGGATTTCTCGAGAAATCCTTCCTTGTTGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-938s1c1
Sequence:CCGGCCTGGCTGAATGCTGAACTTTCTCGAGAAAGTTCAGCATTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2874s1c1
Sequence:CCGGCCAGACTAAGAGTTCTCATAACTCGAGTTATGAGAACTCTTAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-7327s1c1
Sequence:CCGGCCAGGAATCAAAGACGACAATCTCGAGATTGTCGTCTTTGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2671s1c1
Sequence:CCGGCGGCGGAGTATGAGAACTATTCTCGAGAATAGTTCTCATACTCCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-3063s21c1
Sequence:CCGGACGGACTTCTTTAGGTATAAACTCGAGTTTATACCTAAAGAAGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029977
POLQ MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), theta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-4296s21c1
Sequence:CCGGTGTTACTGATTCCCAATTAAACTCGAGTTTAATTGGGAATCAGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-518s21c1
Sequence:CCGGCACGGAAGAAAGCGTTGTTTACTCGAGTAAACAACGCTTTCTTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029977.1-8304s1c1
Sequence:CCGGCGGTCCAACAAGGAAGGATTTCTCGAGAAATCCTTCCTTGTTGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-938s1c1
Sequence:CCGGCCTGGCTGAATGCTGAACTTTCTCGAGAAAGTTCAGCATTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2874s1c1
Sequence:CCGGCCAGACTAAGAGTTCTCATAACTCGAGTTATGAGAACTCTTAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-7327s1c1
Sequence:CCGGCCAGGAATCAAAGACGACAATCTCGAGATTGTCGTCTTTGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2671s1c1
Sequence:CCGGCGGCGGAGTATGAGAACTATTCTCGAGAATAGTTCTCATACTCCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-3063s21c1
Sequence:CCGGACGGACTTCTTTAGGTATAAACTCGAGTTTATACCTAAAGAAGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029977
POLQ MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), theta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-4296s21c1
Sequence:CCGGTGTTACTGATTCCCAATTAAACTCGAGTTTAATTGGGAATCAGTAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-518s21c1
Sequence:CCGGCACGGAAGAAAGCGTTGTTTACTCGAGTAAACAACGCTTTCTTCCGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029977.1-8304s1c1
Sequence:CCGGCGGTCCAACAAGGAAGGATTTCTCGAGAAATCCTTCCTTGTTGGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-938s1c1
Sequence:CCGGCCTGGCTGAATGCTGAACTTTCTCGAGAAAGTTCAGCATTCAGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2874s1c1
Sequence:CCGGCCAGACTAAGAGTTCTCATAACTCGAGTTATGAGAACTCTTAGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-7327s1c1
Sequence:CCGGCCAGGAATCAAAGACGACAATCTCGAGATTGTCGTCTTTGATTCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029977.1-2671s1c1
Sequence:CCGGCGGCGGAGTATGAGAACTATTCTCGAGAATAGTTCTCATACTCCGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029977.2-3063s21c1
Sequence:CCGGACGGACTTCTTTAGGTATAAACTCGAGTTTATACCTAAAGAAGTCCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199420
POLQ MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-2834s21c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-828s21c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-7165s21c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-5970s21c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-3100s21c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199420
POLQ MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-2834s21c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-828s21c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-7165s21c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-5970s21c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-3100s21c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199420
POLQ MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-2834s21c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-828s21c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-7165s21c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-5970s21c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000290547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199420.3-3100s21c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006596
POLQ MISSION shRNA Bacterial Glycerol Stock
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-7441s1c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-6246s1c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3376s1c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-1098s1c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3110s1c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006596
POLQ MISSION shRNA shRNA Plasmid DNA
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-7441s1c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-6246s1c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3376s1c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-1098s1c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3110s1c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006596
POLQ MISSION shRNA Lentiviral Transduction Particles
polymerase (DNA directed), theta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-7441s1c1
Sequence:CCGGCGTCGTCTCATTCAAGTGTTACTCGAGTAACACTTGAATGAGACGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-6246s1c1
Sequence:CCGGCCTTCAATCTTGCTTGCGAAACTCGAGTTTCGCAAGCAAGATTGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000052998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3376s1c1
Sequence:CCGGCGGGCCTCTTTAGATATAAATCTCGAGATTTATATCTAAAGAGGCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-1098s1c1
Sequence:CCGGGCTGACCAAGATTTGCTATATCTCGAGATATAGCAAATCTTGGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000053002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006596.3-3110s1c1
Sequence:CCGGCCCTGTTACATTCTAGTACATCTCGAGATGTACTAGAATGTAACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???