EMAIL THIS PAGE TO A FRIEND

POLR1B

polymerase (RNA) I polypeptide B, 128kDa

71 Gene Product Result for
Synonyms: RPA135 RPA2 Rpo1-2
UniProtKB ID: Q9H9Y6, Q585T5, Q6ZRR2, Q9H9D3
Gene ID:
Human(84172) Summary: Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]
Mouse(20017) polymerase (RNA) I polypeptide B
Rat(83582) polymerase (RNA) I polypeptide B
domestic guinea pig(100723518) polymerase (RNA) I polypeptide B, 128kDa
Domestic Rabbit(100355355) polymerase (RNA) I polypeptide B, 128kDa
naked mole-rat(101702994) polymerase (RNA) I polypeptide B, 128kDa
cow(282342) polymerase (RNA) I polypeptide B, 128kDa
sheep(101113481) polymerase (RNA) I polypeptide B, 128kDa
Zebrafish(325603) polymerase (RNA) I polypeptide B
Horse(100052113) polymerase (RNA) I polypeptide B, 128kDa
domestic cat(101097718) polymerase (RNA) I polypeptide B, 128kDa
dog(100683491) polymerase (RNA) I polypeptide B, 128kDa
chicken(416710) polymerase (RNA) I polypeptide B, 128kDa
chicken(101666986) polymerase (RNA) I polypeptide B, 128kDa
chicken(101749883) polymerase (RNA) I polypeptide B, 128kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019014 Rosetta Predictions human pricing
NM_031773 Rosetta Predictions rat pricing
NM_009086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141021 predicted 1204
2 SASI_Hs01_00141022 predicted 2238
3 SASI_Hs01_00141024 predicted 3569
4 SASI_Hs01_00141025 predicted 2321
5 SASI_Hs02_00352541 predicted 1433
6 SASI_Hs01_00141026 predicted 3325
7 SASI_Hs01_00141027 predicted 2771
8 SASI_Hs02_00352542 predicted 653
9 SASI_Hs01_00141028 predicted 2557
10 SASI_Hs01_00141029 predicted 2046
11 SASI_Hs01_00141023 predicted 2269
12 SASI_Hs01_00141030 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115744 predicted 2820
2 SASI_Rn01_00115745 predicted 802
3 SASI_Rn01_00115746 predicted 2373
4 SASI_Rn01_00115749 predicted 2163
5 SASI_Rn02_00265208 predicted 938
6 SASI_Rn01_00115750 predicted 1037
7 SASI_Rn01_00115751 predicted 2527
8 SASI_Rn01_00115752 predicted 2471
9 SASI_Rn01_00115753 predicted 3043
10 SASI_Rn02_00265209 predicted 1328
11 SASI_Rn01_00115747 predicted 1282
12 SASI_Rn01_00115748 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315290 predicted 3443
2 SASI_Mm02_00315291 predicted 3033
3 SASI_Mm02_00315292 predicted 3525
4 SASI_Mm02_00315293 predicted 2819
5 SASI_Mm02_00315294 predicted 799
6 SASI_Mm02_00315295 predicted 2563
7 SASI_Mm02_00315296 predicted 1268
8 SASI_Mm02_00315297 predicted 397
9 SASI_Mm02_00315298 predicted 2520
10 SASI_Mm02_00315299 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019014
VALIDATED
POLR1B MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide B, 128kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2687s21c1
Sequence:CCGGTATCAAGACCGATCGGATAACCTCGAGGTTATCCGATCGGTCTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2302s21c1
Sequence:CCGGCGCAGATTCTCTTCGTCATTTCTCGAGAAATGACGAAGAGAATCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019014.4-4389s21c1
Sequence:CCGGTTATAGCCACGTTGAAGTAAACTCGAGTTTACTTCAACGTGGCTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3205s21c1
Sequence:CCGGGAACCCAACTATCGGAGATAACTCGAGTTATCTCCGATAGTTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1154s1c1
Sequence:CCGGGCACAGTTATGTTGAACTTTACTCGAGTAAAGTTCAACATAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-2629s1c1
Sequence:CCGGCCCTCCATGTATGATTATTATCTCGAGATAATAATCATACATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1828s1c1
Sequence:CCGGGCTGACAAGCTGAACTTCATACTCGAGTATGAAGTTCAGCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-745s1c1
Sequence:CCGGGCCAATGTTTATCCAGCAGAACTCGAGTTCTGCTGGATAAACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-3832s1c1
Sequence:CCGGGCTATGAACATCAAAGTGAAACTCGAGTTTCACTTTGATGTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3005s21c1
Sequence:CCGGGACGATGGATTGCCGTTTATACTCGAGTATAAACGGCAATCCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3574s21c1
Sequence:CCGGTTATCAGCGCTTACGCCATATCTCGAGATATGGCGTAAGCGCTGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019014
VALIDATED
POLR1B MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide B, 128kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2687s21c1
Sequence:CCGGTATCAAGACCGATCGGATAACCTCGAGGTTATCCGATCGGTCTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2302s21c1
Sequence:CCGGCGCAGATTCTCTTCGTCATTTCTCGAGAAATGACGAAGAGAATCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019014.4-4389s21c1
Sequence:CCGGTTATAGCCACGTTGAAGTAAACTCGAGTTTACTTCAACGTGGCTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3205s21c1
Sequence:CCGGGAACCCAACTATCGGAGATAACTCGAGTTATCTCCGATAGTTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1154s1c1
Sequence:CCGGGCACAGTTATGTTGAACTTTACTCGAGTAAAGTTCAACATAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-2629s1c1
Sequence:CCGGCCCTCCATGTATGATTATTATCTCGAGATAATAATCATACATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1828s1c1
Sequence:CCGGGCTGACAAGCTGAACTTCATACTCGAGTATGAAGTTCAGCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-745s1c1
Sequence:CCGGGCCAATGTTTATCCAGCAGAACTCGAGTTCTGCTGGATAAACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-3832s1c1
Sequence:CCGGGCTATGAACATCAAAGTGAAACTCGAGTTTCACTTTGATGTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3005s21c1
Sequence:CCGGGACGATGGATTGCCGTTTATACTCGAGTATAAACGGCAATCCATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3574s21c1
Sequence:CCGGTTATCAGCGCTTACGCCATATCTCGAGATATGGCGTAAGCGCTGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019014
VALIDATED
POLR1B MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide B, 128kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2687s21c1
Sequence:CCGGTATCAAGACCGATCGGATAACCTCGAGGTTATCCGATCGGTCTTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-2302s21c1
Sequence:CCGGCGCAGATTCTCTTCGTCATTTCTCGAGAAATGACGAAGAGAATCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019014.4-4389s21c1
Sequence:CCGGTTATAGCCACGTTGAAGTAAACTCGAGTTTACTTCAACGTGGCTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3205s21c1
Sequence:CCGGGAACCCAACTATCGGAGATAACTCGAGTTATCTCCGATAGTTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1154s1c1
Sequence:CCGGGCACAGTTATGTTGAACTTTACTCGAGTAAAGTTCAACATAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-2629s1c1
Sequence:CCGGCCCTCCATGTATGATTATTATCTCGAGATAATAATCATACATGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-1828s1c1
Sequence:CCGGGCTGACAAGCTGAACTTCATACTCGAGTATGAAGTTCAGCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019014.3-745s1c1
Sequence:CCGGGCCAATGTTTATCCAGCAGAACTCGAGTTCTGCTGGATAAACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019014.3-3832s1c1
Sequence:CCGGGCTATGAACATCAAAGTGAAACTCGAGTTTCACTTTGATGTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3005s21c1
Sequence:CCGGGACGATGGATTGCCGTTTATACTCGAGTATAAACGGCAATCCATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019014.4-3574s21c1
Sequence:CCGGTTATCAGCGCTTACGCCATATCTCGAGATATGGCGTAAGCGCTGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009086
VALIDATED
POLR1B MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide B, 128kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2602s21c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2261s21c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009086.2-3742s21c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-3705s1c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-1063s1c1
Sequence:CCGGGCAGTCCAACACTGACAAGTTCTCGAGAACTTGTCAGTGTTGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-2821s1c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2225s1c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2857s21c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2566s1c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009086
VALIDATED
POLR1B MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide B, 128kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2602s21c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2261s21c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009086.2-3742s21c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-3705s1c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-1063s1c1
Sequence:CCGGGCAGTCCAACACTGACAAGTTCTCGAGAACTTGTCAGTGTTGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-2821s1c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2225s1c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2857s21c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2566s1c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009086
VALIDATED
POLR1B MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide B, 128kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2602s21c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2261s21c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009086.2-3742s21c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-3705s1c1
Sequence:CCGGGCTGGTCTCAAACTCAGAAATCTCGAGATTTCTGAGTTTGAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-1063s1c1
Sequence:CCGGGCAGTCCAACACTGACAAGTTCTCGAGAACTTGTCAGTGTTGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009086.1-2821s1c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2225s1c1
Sequence:CCGGCCGTGCATGTATGATTTCTATCTCGAGATAGAAATCATACATGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009086.2-2857s21c1
Sequence:CCGGCCGTATGACCATAGGTATGTTCTCGAGAACATACCTATGGTCATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009086.1-2566s1c1
Sequence:CCGGCGTGGTTTACTACAAGAGTAACTCGAGTTACTCTTGTAGTAAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)