EMAIL THIS PAGE TO A FRIEND

POLR1C

polymerase (RNA) I polypeptide C, 30kDa

68 Gene Product Result for
Synonyms: RPA39 RPA40 RPA5 RPAC1 TCS3
UniProtKB ID: O15160, O75395, Q5JTE3
Gene ID:
Human(9533) Summary: The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Defects in this gene have been associated with Treacher Collins syndrome (TCS). [provided by RefSeq, Mar 2011]
Mouse(20016) polymerase (RNA) I polypeptide C
Rat(301246) polymerase (RNA) I polypeptide C
Zebrafish(393538) polymerase (RNA) I polypeptide C
domestic cat(101088162) polymerase (RNA) I polypeptide C, 30kDa
Horse(100055372) polymerase (RNA) I polypeptide C, 30kDa
dog(474912) polymerase (RNA) I polypeptide C, 30kDa
chicken(421452) polymerase (RNA) I polypeptide C, 30kDa
cow(516337) polymerase (RNA) I polypeptide C, 30kDa
sheep(101114821) polymerase (RNA) I polypeptide C, 30kDa
Goat(100861003) polymerase (RNA) I polypeptide C, 30kDa
naked mole-rat(101709947) polymerase (RNA) I polypeptide C, 30kDa
Domestic Rabbit(100357236) polymerase (RNA) I polypeptide C, 30kDa
domestic guinea pig(100732680) polymerase (RNA) I polypeptide C, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004875 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004875 Rosetta Predictions human pricing
NM_203290 Rosetta Predictions human pricing
NM_001008330 Rosetta Predictions rat pricing
NM_009085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024370 predicted 277
2 SASI_Hs01_00024371 predicted 678
3 SASI_Hs01_00024372 predicted 450
4 SASI_Hs01_00024374 predicted 704
5 SASI_Hs01_00024375 predicted 529
6 SASI_Hs01_00024376 predicted 306
7 SASI_Hs01_00024377 predicted 343
8 SASI_Hs01_00024378 predicted 601
9 SASI_Hs02_00338507 predicted 233
10 SASI_Hs02_00338508 predicted 447
11 SASI_Hs01_00024373 predicted 751
12 SASI_Hs01_00024379 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135359 predicted 280
2 SASI_Hs01_00135360 predicted 678
3 SASI_Hs01_00135361 predicted 446
4 SASI_Hs01_00135363 predicted 709
5 SASI_Hs01_00135364 predicted 528
6 SASI_Hs01_00135365 predicted 301
7 SASI_Hs01_00135366 predicted 340
8 SASI_Hs01_00135367 predicted 594
9 SASI_Hs02_00373207 predicted 238
10 SASI_Hs02_00373208 predicted 447
11 SASI_Hs01_00135362 predicted 746
12 SASI_Hs01_00135368 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043887 predicted 533
2 SASI_Rn01_00043888 predicted 750
3 SASI_Rn01_00043889 predicted 389
4 SASI_Rn01_00043890 predicted 347
5 SASI_Rn02_00199073 predicted 402
6 SASI_Rn01_00043891 predicted 269
7 SASI_Rn01_00043892 predicted 564
8 SASI_Rn01_00043893 predicted 950
9 SASI_Rn01_00043894 predicted 449
10 SASI_Rn01_00043895 predicted 919
11 SASI_Rn01_00043896 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158290 predicted 576
2 SASI_Mm01_00158291 predicted 200
3 SASI_Mm01_00158292 predicted 198
4 SASI_Mm02_00315285 predicted 436
5 SASI_Mm02_00315286 predicted 855
6 SASI_Mm01_00158295 predicted 945
7 SASI_Mm01_00158296 predicted 337
8 SASI_Mm02_00315287 predicted 431
9 SASI_Mm02_00315288 predicted 1040
10 SASI_Mm02_00315289 predicted 499
11 SASI_Mm01_00158289 predicted 348
12 SASI_Mm01_00158293 predicted 891
13 SASI_Mm01_00158294 predicted 957
14 SASI_Mm01_00158297 predicted 369
15 SASI_Mm01_00158298 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009085
VALIDATED
POLR1C MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide C, 30kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-429s21c1
Sequence:CCGGTCGCTGATCCTCGTCTCTTTGCTCGAGCAAAGAGACGAGGATCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-697s21c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-982s21c1
Sequence:CCGGCCGGGTTCGGGACCATTATATCTCGAGATATAATGGTCCCGAACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-946s21c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009085.2-1147s21c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-299s21c1
Sequence:CCGGGCCAATGCTTTCCGGAGAATCCTCGAGGATTCTCCGGAAAGCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-323s21c1
Sequence:CCGGTTAGCTGAGGTGCCGACAATGCTCGAGCATTGTCGGCACCTCAGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009085.1-1162s1c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-712s1c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-961s1c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-377s1c1
Sequence:CCGGGTGTATAACAACACGTCCATACTCGAGTATGGACGTGTTGTTATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-185s1c1
Sequence:CCGGCCCGGTAACTACGCCGGTTATCTCGAGATAACCGGCGTAGTTACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009085
VALIDATED
POLR1C MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide C, 30kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-429s21c1
Sequence:CCGGTCGCTGATCCTCGTCTCTTTGCTCGAGCAAAGAGACGAGGATCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-697s21c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-982s21c1
Sequence:CCGGCCGGGTTCGGGACCATTATATCTCGAGATATAATGGTCCCGAACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-946s21c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009085.2-1147s21c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-299s21c1
Sequence:CCGGGCCAATGCTTTCCGGAGAATCCTCGAGGATTCTCCGGAAAGCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-323s21c1
Sequence:CCGGTTAGCTGAGGTGCCGACAATGCTCGAGCATTGTCGGCACCTCAGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009085.1-1162s1c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-712s1c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-961s1c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-377s1c1
Sequence:CCGGGTGTATAACAACACGTCCATACTCGAGTATGGACGTGTTGTTATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-185s1c1
Sequence:CCGGCCCGGTAACTACGCCGGTTATCTCGAGATAACCGGCGTAGTTACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009085
VALIDATED
POLR1C MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide C, 30kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-429s21c1
Sequence:CCGGTCGCTGATCCTCGTCTCTTTGCTCGAGCAAAGAGACGAGGATCAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-697s21c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-982s21c1
Sequence:CCGGCCGGGTTCGGGACCATTATATCTCGAGATATAATGGTCCCGAACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-946s21c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009085.2-1147s21c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-299s21c1
Sequence:CCGGGCCAATGCTTTCCGGAGAATCCTCGAGGATTCTCCGGAAAGCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009085.2-323s21c1
Sequence:CCGGTTAGCTGAGGTGCCGACAATGCTCGAGCATTGTCGGCACCTCAGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009085.1-1162s1c1
Sequence:CCGGGCGTGGCTGCTCTTGGATCTTCTCGAGAAGATCCAAGAGCAGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-712s1c1
Sequence:CCGGCCAGGAAATTGACTTGATGATCTCGAGATCATCAAGTCAATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-961s1c1
Sequence:CCGGCCGGCATGAGAAACTCAAGAACTCGAGTTCTTGAGTTTCTCATGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009085.1-377s1c1
Sequence:CCGGGTGTATAACAACACGTCCATACTCGAGTATGGACGTGTTGTTATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009085.1-185s1c1
Sequence:CCGGCCCGGTAACTACGCCGGTTATCTCGAGATAACCGGCGTAGTTACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004875
VALIDATED
POLR1C MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide C, 30kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-326s21c1
Sequence:CCGGAGAAGGTCCTGGTGTACAATACTCGAGTATTGTACACCAGGACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-822s21c1
Sequence:CCGGGTGCTTCTCACCTGGTGTTATCTCGAGATAACACCAGGTGAGAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-627s21c1
Sequence:CCGGCCGACCAGTGCATGATGATATCTCGAGATATCATCATGCACTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004875.2-241s21c1
Sequence:CCGGGAGTTTGACATGGTGGGAATTCTCGAGAATTCCCACCATGTCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-298s21c1
Sequence:CCGGCTAGCTGAGGTGCCAACTATGCTCGAGCATAGTTGGCACCTCAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-145s1c1
Sequence:CCGGCCCGGTAACTATTCCGGTTATCTCGAGATAACCGGAATAGTTACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-672s1c1
Sequence:CCGGCCAAGAAATTGACCTGCTCATCTCGAGATGAGCAGGTCAATTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-956s1c1
Sequence:CCGGCCCGGGTTCGAGATCATTATACTCGAGTATAATGATCTCGAACCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-537s1c1
Sequence:CCGGCGAACTGTACGTGAACCACAACTCGAGTTGTGGTTCACGTACAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004875
VALIDATED
POLR1C MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide C, 30kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-326s21c1
Sequence:CCGGAGAAGGTCCTGGTGTACAATACTCGAGTATTGTACACCAGGACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-822s21c1
Sequence:CCGGGTGCTTCTCACCTGGTGTTATCTCGAGATAACACCAGGTGAGAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-627s21c1
Sequence:CCGGCCGACCAGTGCATGATGATATCTCGAGATATCATCATGCACTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004875.2-241s21c1
Sequence:CCGGGAGTTTGACATGGTGGGAATTCTCGAGAATTCCCACCATGTCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-298s21c1
Sequence:CCGGCTAGCTGAGGTGCCAACTATGCTCGAGCATAGTTGGCACCTCAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-145s1c1
Sequence:CCGGCCCGGTAACTATTCCGGTTATCTCGAGATAACCGGAATAGTTACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-672s1c1
Sequence:CCGGCCAAGAAATTGACCTGCTCATCTCGAGATGAGCAGGTCAATTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-956s1c1
Sequence:CCGGCCCGGGTTCGAGATCATTATACTCGAGTATAATGATCTCGAACCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-537s1c1
Sequence:CCGGCGAACTGTACGTGAACCACAACTCGAGTTGTGGTTCACGTACAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004875
VALIDATED
POLR1C MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide C, 30kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-326s21c1
Sequence:CCGGAGAAGGTCCTGGTGTACAATACTCGAGTATTGTACACCAGGACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-822s21c1
Sequence:CCGGGTGCTTCTCACCTGGTGTTATCTCGAGATAACACCAGGTGAGAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-627s21c1
Sequence:CCGGCCGACCAGTGCATGATGATATCTCGAGATATCATCATGCACTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004875.2-241s21c1
Sequence:CCGGGAGTTTGACATGGTGGGAATTCTCGAGAATTCCCACCATGTCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004875.2-298s21c1
Sequence:CCGGCTAGCTGAGGTGCCAACTATGCTCGAGCATAGTTGGCACCTCAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-145s1c1
Sequence:CCGGCCCGGTAACTATTCCGGTTATCTCGAGATAACCGGAATAGTTACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-672s1c1
Sequence:CCGGCCAAGAAATTGACCTGCTCATCTCGAGATGAGCAGGTCAATTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-956s1c1
Sequence:CCGGCCCGGGTTCGAGATCATTATACTCGAGTATAATGATCTCGAACCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004875.2-537s1c1
Sequence:CCGGCGAACTGTACGTGAACCACAACTCGAGTTGTGGTTCACGTACAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)