EMAIL THIS PAGE TO A FRIEND

POLR1D

polymerase (RNA) I polypeptide D, 16kDa

140 Gene Product Result for
Synonyms: AC19 POLR1C RPA16 RPA9 RPAC2 RPC16 RPO1-3 TCS2
UniProtKB ID: Q9Y2S0, Q5TBX2, Q96BR3
Gene ID:
Human(51082) Summary: The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
Mouse(20018) polymerase (RNA) I polypeptide D
naked mole-rat(101715737) polymerase (RNA) I polypeptide D, 16kDa
cow(539061) polymerase (RNA) I polypeptide D, 16kDa
sheep(101114283) polymerase (RNA) I polypeptide D, 16kDa
cow(616972) polymerase (RNA) I polypeptide D
Zebrafish(445412) polymerase (RNA) I polypeptide D
domestic cat(101087802) polymerase (RNA) I polypeptide D, 16kDa
dog(100686016) polymerase (RNA) I polypeptide D, 16kDa
chicken(428713) polymerase (RNA) I polypeptide D, 16kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015972 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015972 Rosetta Predictions human pricing
NM_152705 Rosetta Predictions human pricing
NM_009087 Rosetta Predictions mouse pricing
NM_181730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159872 predicted 198
2 SASI_Hs01_00159873 predicted 220
3 SASI_Hs02_00348638 predicted 270
4 SASI_Hs01_00159876 predicted 207
5 SASI_Hs02_00348639 predicted 350
6 SASI_Hs01_00159877 predicted 236
7 SASI_Hs01_00159879 predicted 406
8 SASI_Hs02_00348640 predicted 302
9 SASI_Hs01_00159880 predicted 397
10 SASI_Hs01_00159881 predicted 332
11 SASI_Hs01_00159874 predicted 407
12 SASI_Hs01_00159875 predicted 414
13 SASI_Hs01_00159878 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072825 predicted 902
2 SASI_Hs01_00072827 predicted 904
3 SASI_Hs01_00072828 predicted 200
4 SASI_Hs01_00072830 predicted 356
5 SASI_Hs01_00072831 predicted 904
6 SASI_Hs02_00366600 predicted 219
7 SASI_Hs01_00072832 predicted 315
8 SASI_Hs01_00072826 predicted 221
9 SASI_Hs01_00072829 predicted 250
10 SASI_Hs01_00072833 predicted 678
11 SASI_Hs01_00072834 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108160 predicted 233
2 SASI_Mm01_00108161 predicted 449
3 SASI_Mm01_00108162 predicted 276
4 SASI_Mm02_00315300 predicted 282
5 SASI_Mm01_00108163 predicted 270
6 SASI_Mm01_00108164 predicted 413
7 SASI_Mm01_00108165 predicted 222
8 SASI_Mm01_00108166 predicted 472
9 SASI_Mm01_00108167 predicted 227
10 SASI_Mm01_00108168 predicted 201
11 SASI_Mm01_00108169 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140427 predicted 228
2 SASI_Mm01_00140428 predicted 260
3 SASI_Mm01_00140429 predicted 296
4 SASI_Mm01_00140430 predicted 233
5 SASI_Mm01_00140431 predicted 226
6 SASI_Mm01_00140432 predicted 203
7 SASI_Mm01_00140433 predicted 348
8 SASI_Mm02_00349895 predicted 229
9 SASI_Mm01_00140435 predicted 270
10 SASI_Mm01_00140436 predicted 366
11 SASI_Mm01_00140434 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152705
VALIDATED
POLR1D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide D, 16kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-276s21c1
Sequence:CCGGACACATTGCCCTCTCATAAAGCTCGAGCTTTATGAGAGGGCAATGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-207s21c1
Sequence:CCGGGACCCATGGGTTGGATGAAGTCTCGAGACTTCATCCAACCCATGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-1225s1c1
Sequence:CCGGGCCAGCTAAAGACTTGTGATACTCGAGTATCACAAGTCTTTAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152705.1-370s1c1
Sequence:CCGGGAAACACAGAAGCCATCCTTACTCGAGTAAGGATGGCTTCTGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-193s21c1
Sequence:CCGGAGCTGAAACAATGGGACCCATCTCGAGATGGGTCCCATTGTTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-365s1c1
Sequence:CCGGCCGAAGAAACACAGAAGCCATCTCGAGATGGCTTCTGTGTTTCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-711s1c1
Sequence:CCGGGCAGTGTAGTAGACTTACATACTCGAGTATGTAAGTCTACTACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-577s1c1
Sequence:CCGGCCTGAGAGTGACTTTGACATTCTCGAGAATGTCAAAGTCACTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-145s1c1
Sequence:CCGGGAAAGCAATAGAAGAACTGCTCTCGAGAGCAGTTCTTCTATTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-321s21c1
Sequence:CCGGGCGATAAGGAACCAGCGAAGACTCGAGTCTTCGCTGGTTCCTTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-218s21c1
Sequence:CCGGTGGATGAAGTGTCCTCTTGCTCTCGAGAGCAAGAGGACACTTCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-968s1c1
Sequence:CCGGGCTCTTTGATAGCTCTGCATTCTCGAGAATGCAGAGCTATCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152705
VALIDATED
POLR1D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide D, 16kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-276s21c1
Sequence:CCGGACACATTGCCCTCTCATAAAGCTCGAGCTTTATGAGAGGGCAATGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-207s21c1
Sequence:CCGGGACCCATGGGTTGGATGAAGTCTCGAGACTTCATCCAACCCATGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-1225s1c1
Sequence:CCGGGCCAGCTAAAGACTTGTGATACTCGAGTATCACAAGTCTTTAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152705.1-370s1c1
Sequence:CCGGGAAACACAGAAGCCATCCTTACTCGAGTAAGGATGGCTTCTGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-193s21c1
Sequence:CCGGAGCTGAAACAATGGGACCCATCTCGAGATGGGTCCCATTGTTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-365s1c1
Sequence:CCGGCCGAAGAAACACAGAAGCCATCTCGAGATGGCTTCTGTGTTTCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-711s1c1
Sequence:CCGGGCAGTGTAGTAGACTTACATACTCGAGTATGTAAGTCTACTACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-577s1c1
Sequence:CCGGCCTGAGAGTGACTTTGACATTCTCGAGAATGTCAAAGTCACTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-145s1c1
Sequence:CCGGGAAAGCAATAGAAGAACTGCTCTCGAGAGCAGTTCTTCTATTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-321s21c1
Sequence:CCGGGCGATAAGGAACCAGCGAAGACTCGAGTCTTCGCTGGTTCCTTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-218s21c1
Sequence:CCGGTGGATGAAGTGTCCTCTTGCTCTCGAGAGCAAGAGGACACTTCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-968s1c1
Sequence:CCGGGCTCTTTGATAGCTCTGCATTCTCGAGAATGCAGAGCTATCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152705
VALIDATED
POLR1D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide D, 16kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-276s21c1
Sequence:CCGGACACATTGCCCTCTCATAAAGCTCGAGCTTTATGAGAGGGCAATGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-207s21c1
Sequence:CCGGGACCCATGGGTTGGATGAAGTCTCGAGACTTCATCCAACCCATGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-1225s1c1
Sequence:CCGGGCCAGCTAAAGACTTGTGATACTCGAGTATCACAAGTCTTTAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152705.1-370s1c1
Sequence:CCGGGAAACACAGAAGCCATCCTTACTCGAGTAAGGATGGCTTCTGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-193s21c1
Sequence:CCGGAGCTGAAACAATGGGACCCATCTCGAGATGGGTCCCATTGTTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-365s1c1
Sequence:CCGGCCGAAGAAACACAGAAGCCATCTCGAGATGGCTTCTGTGTTTCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-711s1c1
Sequence:CCGGGCAGTGTAGTAGACTTACATACTCGAGTATGTAAGTCTACTACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_152705.1-577s1c1
Sequence:CCGGCCTGAGAGTGACTTTGACATTCTCGAGAATGTCAAAGTCACTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152705.1-145s1c1
Sequence:CCGGGAAAGCAATAGAAGAACTGCTCTCGAGAGCAGTTCTTCTATTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-321s21c1
Sequence:CCGGGCGATAAGGAACCAGCGAAGACTCGAGTCTTCGCTGGTTCCTTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152705.1-218s21c1
Sequence:CCGGTGGATGAAGTGTCCTCTTGCTCTCGAGAGCAAGAGGACACTTCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152705.1-968s1c1
Sequence:CCGGGCTCTTTGATAGCTCTGCATTCTCGAGAATGCAGAGCTATCAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009087
VALIDATED
POLR1D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide D, 16kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-292s21c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-410s21c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-232s21c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009087.1-537s1c1
Sequence:CCGGTGCAGGGTACAAGCAGGACCACTCGAGTGGTCCTGCTTGTACCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-410s1c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-292s1c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-232s1c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009087.1-473s1c1
Sequence:CCGGGCCAGCATAAAGGACTATAAACTCGAGTTTATAGTCCTTTATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-260s21c1
Sequence:CCGGCACGAGGAGGACCATACACTACTCGAGTAGTGTATGGTCCTCCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009087
VALIDATED
POLR1D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide D, 16kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-292s21c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-410s21c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-232s21c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009087.1-537s1c1
Sequence:CCGGTGCAGGGTACAAGCAGGACCACTCGAGTGGTCCTGCTTGTACCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-410s1c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-292s1c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-232s1c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009087.1-473s1c1
Sequence:CCGGGCCAGCATAAAGGACTATAAACTCGAGTTTATAGTCCTTTATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-260s21c1
Sequence:CCGGCACGAGGAGGACCATACACTACTCGAGTAGTGTATGGTCCTCCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009087
VALIDATED
POLR1D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide D, 16kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-292s21c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-410s21c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-232s21c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009087.1-537s1c1
Sequence:CCGGTGCAGGGTACAAGCAGGACCACTCGAGTGGTCCTGCTTGTACCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-410s1c1
Sequence:CCGGCCGTTTCAGAAAGGCCTGAATCTCGAGATTCAGGCCTTTCTGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-292s1c1
Sequence:CCGGGCGGTACATAATCATGAAGAACTCGAGTTCTTCATGATTATGTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009087.1-232s1c1
Sequence:CCGGAGATAGACAGTGTGTGACATTCTCGAGAATGTCACACACTGTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009087.1-473s1c1
Sequence:CCGGGCCAGCATAAAGGACTATAAACTCGAGTTTATAGTCCTTTATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009087.1-260s21c1
Sequence:CCGGCACGAGGAGGACCATACACTACTCGAGTAGTGTATGGTCCTCCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015972
POLR1D MISSION shRNA Bacterial Glycerol Stock
polymerase (RNA) I polypeptide D, 16kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-436s1c1
Sequence:CCGGGAGGCCAGCATAAAGGACTATCTCGAGATAGTCCTTTATGCTGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-198s1c1
Sequence:CCGGAGATAGACACTGTGTGACATTCTCGAGAATGTCACACAGTGTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-469s1c1
Sequence:CCGGGCAAGCAGAAATGAATCCACACTCGAGTGTGGATTCATTTCTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-243s1c1
Sequence:CCGGCCTAGGAAATTCTCTACGTTACTCGAGTAACGTAGAGAATTTCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015972.1-560s1c1
Sequence:CCGGCAGAATTAGAAGTTTGTGGTTCTCGAGAACCACAAACTTCTAATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015972
POLR1D MISSION shRNA shRNA Plasmid DNA
polymerase (RNA) I polypeptide D, 16kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-436s1c1
Sequence:CCGGGAGGCCAGCATAAAGGACTATCTCGAGATAGTCCTTTATGCTGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-198s1c1
Sequence:CCGGAGATAGACACTGTGTGACATTCTCGAGAATGTCACACAGTGTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-469s1c1
Sequence:CCGGGCAAGCAGAAATGAATCCACACTCGAGTGTGGATTCATTTCTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-243s1c1
Sequence:CCGGCCTAGGAAATTCTCTACGTTACTCGAGTAACGTAGAGAATTTCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015972.1-560s1c1
Sequence:CCGGCAGAATTAGAAGTTTGTGGTTCTCGAGAACCACAAACTTCTAATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015972
POLR1D MISSION shRNA Lentiviral Transduction Particles
polymerase (RNA) I polypeptide D, 16kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-436s1c1
Sequence:CCGGGAGGCCAGCATAAAGGACTATCTCGAGATAGTCCTTTATGCTGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-198s1c1
Sequence:CCGGAGATAGACACTGTGTGACATTCTCGAGAATGTCACACAGTGTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-469s1c1
Sequence:CCGGGCAAGCAGAAATGAATCCACACTCGAGTGTGGATTCATTTCTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015972.1-243s1c1
Sequence:CCGGCCTAGGAAATTCTCTACGTTACTCGAGTAACGTAGAGAATTTCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015972.1-560s1c1
Sequence:CCGGCAGAATTAGAAGTTTGTGGTTCTCGAGAACCACAAACTTCTAATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)